Latitude influences your weather by determining which type of weather systems will cross the area and how frequently, elevation influences your weather because higher elevations have lower air pressure than lower elevations, thus allowing the air to be colder on average. Local geography influences your weather due to different areas being nearby mountain ranges, bodies of water, and other things that can create or dissimilate different weather systems.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer: Here are all the ways mindfulness can help you manage stress: Nine Ways Mindfulness Helps with Stress. You become more aware of your thoughts. You can then step back from them and not take them so literally. That way, your stress response is not initiated in the first place. You don’t immediately react to a situation. Instead, you have a moment to pause and then use your “wise mind” to come up with the best solution.
Explanation:
It is called the Epidermis. The epidermis, the outermost layer of skin, provides a waterproof barrier and creates our skin tone. The dermis, beneath the epidermis, contains tough connective tissue, hair follicles, and sweat glands.
