1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vinvika [58]
1 year ago
15

To understand the chemical basis of inheritance, we must understand the molecular structure of dna. this is an example of the ap

plication of which concept to the study of biology?
Biology
1 answer:
noname [10]1 year ago
4 0

The answer is <u>reductionism.</u>

<u></u>

To understand the chemical basis of inheritance, we must understand the molecular structure of DNA. This is an example of the application of <u>reductionism.</u>

<u></u>

What is reductionism?

According to the reductionist theory, comprehending a system's simpler components is essential to comprehending the system as a whole. You may think of this as a bottom-up method in biology, where you start at the most basic level and work your way up to the most sophisticated, where minute bits make up each new level of the whole.

The chemical underpinnings of many life activities have been successfully explained using the reductionist approach, which breaks biological systems down into their component pieces. However, a lot of biologists now understand that this strategy has been exhausted. Incredibly complex biological systems exhibit emergent qualities that cannot be understood or even predicted by looking at their component parts separately. Although effective in the early days of molecular biology, the reductionist approach underestimates this complexity, which has a negative impact on many fields of biomedical research, such as drug discovery and vaccine creation.

To know more about molecular biology click on the link below:

brainly.com/question/26044300

#SPJ4

You might be interested in
PLEASE ANSWER CORRECTLY!!!!! LOTS OF POINTS
UkoKoshka [18]

<u>The four types of interactions in communities are:</u>

  • Mutualism
  • Parasitism
  • Commensalism
  • Competition

<u>Definition of each interaction:</u>

<em>Mutualism: </em>

The type of interaction in which both the species involved are benefited, it is called mutualism.

<em>Parasitism:</em>

The type of interaction in which one species is benefited, whereas the other is harmed, it is called parasitism.

<em>Commensalism:</em>

The type of interaction in which one species gets benefited without harming or providing benefits to others is called commensalism.

<em>Competition:</em>

The type of interaction in which both species lose is called competition. It is opposite of mutualism.

<u>Symbiotic relationship:</u>

It refers to the type of interaction in which lastly one species gets benefited. The type of interactions such as <em>mutualism, commensalism, and Parasitism </em>are considered as symbiotic relationship.

7 0
4 years ago
This animal represents what kind of body symmetry?:
fomenos
What is this animal and i can answer it
4 0
3 years ago
Read 2 more answers
If we put a plant and animal cell into a solution that contains no solutes at all , the solution is______
frosja888 [35]
The answer is isotonic
3 0
3 years ago
Read 2 more answers
The drug chloral hydrate prevents elongation of microtubules. During which stage of the cell cycle would chloral hydrate be most
puteri [66]

Answer: G1 phase

Explanation:

Hope this helps!

4 0
3 years ago
Which process involves glucose reacting with oxygen to provide energy carbon dioxide and water
Aleks [24]

Answer:

The process in which glucose react with oxygen to provide energy and carbon dioxide and water is called <em><u>Cellular</u></em><em><u> </u></em><em><u>respiration</u></em><em><u> </u></em><em><u>.</u></em>

<h2><em><u>MORE</u></em><em><u> </u></em><em><u>TO</u></em><em><u> </u></em><em><u>KNOW</u></em><em><u> </u></em></h2>

  • Glucose break down into 3 carbon molecule pyruvate .

  • The energy produced is used to synthesis ATP which is a power house of cell.

  • Cellular takes place in Mitochondria . It is an organelle in cell

  • ATP is adenosine triphosphate

  • ATP is utilised in maintained function of cell, synthesise protein and other works
8 0
3 years ago
Read 2 more answers
Other questions:
  • What does it mean for an atom's behavior if it missing electrons in the valence shell?
    14·1 answer
  • Differences between a palisade cell and a fungal hypha
    6·1 answer
  • What must always happen before a hypothesis can be formed
    13·1 answer
  • How is the the net production (NP) of a crop field calculated? What are factors that will affect the NP?
    15·2 answers
  • Recognize ile USL Common Elements (0.JD).QuesLUIT
    7·1 answer
  • What would happen if the habitat of white-tailed deer decreases in size? A. The number of white-tailed deer will increase. B. Wh
    14·1 answer
  • Endoplasmic reticulum is best described as a
    14·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • A eukaryotic cell carries out phagocytosis and engulfs a gram-negative bacterial cell, which ends up in the resulting food vacuo
    9·1 answer
  • Question #8
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!