1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solniwko [45]
1 year ago
10

DUE NOW PLS HELP MEEEE!!!!!

Biology
1 answer:
blagie [28]1 year ago
5 0

Each fossil with the layer where it will be present based on are layer A-BIRDS, layer B -dinosaurs , layer C-amphibians, layer D-Corals ,layer E -trilobites.

<h3>What is the oldest fossil layer?</h3>

The Pilbara area of western Australia's Strelley Pool is home to the oldest known fossils. Stromatolites are fossilized mats of microorganisms wedged between sedimentary layers. The fossils have an age of 3.4 billion years.

<h3>How are the layers containing the fossils organized?</h3>

The Law of Superposition, which asserts that in undisturbed rock sequences, the bottom layers are earlier than the top ones, is the foundation for this theory. Because of this, certain fossil discoveries can be dated using the strata—a particular stratum of rock—in which they were discovered.

TO know about fossil Layer visit:

brainly.com/question/11799178

#SPJ13

You might be interested in
16. The substances that are reabsorbed did not diffuse (move) from the nephron bowl into the
SpyIntel [72]

Answer:

Active transport.

Explanation:

The kidney uses active transport  to move these substances from the nephron to the  renal vein because these substances did not moves from the nephron bowl to the renal vein through simple diffusion so for this purpose active transport is used in which energy is spent in order to move the substances from one region to another so we can say that kidney must use active transport to move reabsorbed substances from the nephron to the  renal vein.

4 0
2 years ago
What happens last when the government does the census?
Virty [35]

Answer:

A

Explanation:

after the whole mailing process, the gov calculates the number of citizens per country

5 0
3 years ago
What did gregor mendel want to find out when he decided to study pea plants.
Alexxx [7]

Answer:

How traits/characters were passed down and inherited from parents to offspring.

7 0
2 years ago
If a human body system does not function correctly what is most likely result?
Natalka [10]
It could cause you Death, and/or diseases
4 0
2 years ago
Read 2 more answers
Which of the following is the relatively smallest organism?
Fed [463]

Answer:

Mycoplasma genitalium

Explanation:

a parasitic bacterium which lives in the primate bladder, waste disposal organs, genital, and respiratory tracts, is thought to be the smallest known organism capable of independent growth and reproduction

4 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • URGENT!!! Please help :((
    14·1 answer
  • In his study of pea plants , Gregor Mendel used which method to produce offspring?
    11·2 answers
  • A nonpregnant woman requires 46 grams of protein per day. how many grams per day would she need if she became pregnant?
    15·1 answer
  • What is the answer to number one
    10·2 answers
  • A certain kind of plant can have green leaves (G) or yellow leaves (g) and can
    13·1 answer
  • Which term specifically describes the categorization of people into ethnic groups without taking into account individual differe
    15·2 answers
  • Triangle XY Z is similar to triangle PQR.<br><br><br> Solve for n.
    5·2 answers
  • 4. Which might change, depending on the
    6·1 answer
  • What is a malformed frog
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!