1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qwelly [4]
1 year ago
14

What are the requirements when checking in PSE products?.

Biology
1 answer:
Maurinko [17]1 year ago
3 0

The correct statements are : A ,D ,E , F

A Date received must be documented on each page of the invoice

D Handwritten verification marks (circle, slash, checkmark, etc.) to confirm receipt of each product must be documented on the invoice

E Signature documented on each page of the invoice

F All CIII-V's and PSE products should be checked into the electronic delivery check-in screen via CFRX.

The kind of identification used, the government agency issuing it, the identification number, the name and address of each buyer, the product they purchased that includes ephedrine or pseudoephedrine, including how many grams it contains.

Each page of the invoice must include the date it was received. Documented initials on each page of the invoice If state laws permit, technicians can check in orders for CIII-V and PSE items. Handwritten verification marks (circle, slash, checkmark, etc.) must be recorded on the.

Check-in Requirements: For domestic flights, most airlines advise that you go to the airport at least two hours before departure, and three hours for international flights. Please have your government-issued ID and electronic ticket number available.

Learn more about to PSE products visit here:

brainly.com/question/26603693

#SPJ4

Full Question :

What are the requirements when checking in ClII-Vand PSE products?

A Date received must be documented on each page of the invoice

B Initials documented on each page of the invoice

C Technicians can check in CIII-V and PSE products orders if state regulations allow

D Handwritten verification marks (circle, slash, checkmark, etc.) to confirm receipt of each product must be documented on the invoice

E Signature documented on each page of the invoice

F All CIII-V's and PSE products should be checked into the electronic delivery check-in screen via CFRX.

You might be interested in
In the diagram of the human digestive system, what organ is labelled 5?
il63 [147K]

Answer:

The large intestine

Explanation:

The large intestine is a long, tube-like organ connected to both the small intestine and the anus. In an anatomy drawing, it looks almost as if it is wrapped around the small intestine.

As we can see in the drawing, the organ labelled with 5 is wrapped around another organ which is smaller and looks longer. This smaller organ is the <em>small intestine</em>. Since we know that the large intestine <em>wraps around</em> the small intestine, we can infer that the organ is the large intestine.

Hopefully that was helpful! :)

8 0
2 years ago
The arrow points to an example of
Over [174]

Answer:

Sound Barrier

Explanation:

8 0
2 years ago
What is a qualitative observation?
ad-work [718]

Answer:

A qualitative observation involves the use of five sensory organs, sight, smell, taste, touch, and hearing, and their function to examine the attributes. Being subjective in nature, it focuses on the characteristics and qualities of the variables rather than the numerical value.

Explanation:

mark as a brainliest answer if it helps you

6 0
2 years ago
Read 2 more answers
At which trophic level are woodmice and grey squirrels?
Sati [7]

Answer:

Primary Consumers

Explanation:

3 0
3 years ago
A student decides to be the subject in her own experiment. She wants to know how the amount of time she spends studying for a te
Pavel [41]

Answer:

Test Variable (independent variable)

Explanation:

X is always the independent variable/time. Test grades is dependent because it's the outcome. Trust me I took the test.

6 0
3 years ago
Other questions:
  • What is the main difference between oogenesis and spermatogenesis in terms of meiosis?
    14·1 answer
  • In eukaryotes, glycolysis typically occurs in the _____, gluconeogenesis typically occurs in the _____
    5·1 answer
  • PLEASE ANSWER !
    5·1 answer
  • The majority of people in United States work in the___industry A agriculture B fishing C mining D service
    13·2 answers
  • Oil glands are also called
    12·2 answers
  • What helps determine a
    8·2 answers
  • What is the word for a sequence of steps used to define and solve a problem
    10·1 answer
  • I BEG U PLZ HELP ANYONE. My test finishes in 15m so plz answer.
    9·1 answer
  • What is the melting point of a substance?
    14·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!