1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AveGali [126]
3 years ago
8

What is a stem cell?

Biology
2 answers:
dangina [55]3 years ago
3 0
I undifferentiated cell of a multicellular organism which is capable of giving rise to indefinitely more cells of the same type, and from which certain other kinds of cell arise by differentiation.
Cloud [144]3 years ago
3 0

An undifferentiated cell of a multicellular organism which is capable of giving rise to indefinitely more cells of the same type, and form which certain other kinds of cell arise by differentiation

You might be interested in
The major cause of water pollution by industries involves
Luba_88 [7]

Answer:

Toxic chemicals is a major cause of water pollution. In most cases, the toxic chemicals came from the residual from production process after companies done making their product

Explanation:

3 0
2 years ago
In 2006, scientists found a fossil that seemed to have fish-like scales and four legs. It also had a bone structure in its neck
lianna [129]

Answer:

Option-C

Explanation:

Scientists found a fossil of a fish with four limbs or legs. The fossil was estimated to be around 375 million years old.  

The fossil showed the fins and scales of a fish but they also possess the bones of proto-wrist, shoulders and the elbow.

The presence of these bones can be a clue that the fish evolved the limbs to walk on the land and will later evolve into animals belonging to amphibians, reptiles and mammals. Therefore, the Tiktaalik is considered the missing link of how life evolved from water to land.

Thus, Option-C is correct.

4 0
3 years ago
A college student goes to the er with symptoms of headache and high fever for the past two days. a lumbar puncture is performed
Thepotemich [5.8K]

CPT Code 62270

CPT Code 62270 is under Injection, drainage or aspiration procedures of the spine and spinal cord. This is fitting for the patient who has had a diagnostic lumbar puncture where a small amount of cerebrospinal fluid is removed for laboratory testing.

6 0
3 years ago
During DNA Replication, a DNA strand that has the bases 3'ATACGC5' produces a strand with the bases
Gemiola [76]

During DNA Replication, the DNA strand that has the bases 3'ATACGC5' produces a strand with the bases 5'TATGCG3'  

Answer: Option B

<u>Explanation:</u>

The DNA Replication produces the newly formed two complimentary base pair strand from the two template base pair strand, so basically the already existing DNA strand is replicated, in order to produce complimentary DNA strand, with the template giving one strand to new each.

Thereby, here the given base was 3' ATACGC 5' so the first thing to produce the strand will be that the coding end will be reversed so the 3' end will have 5' end and 5' end will have 3' end. Then A bonds with T and T bonds with A and, so C bonds with G and G bonds with C, therefore, ATACGC will produce TATGCG. Thereby, answer would be 5'TATGCG3'.

3 0
3 years ago
A lending library has a fixed charge for the first three days and an additional charge for each day thereafter. Saritha paid ₹27
san4es73 [151]

Answer:

See the attachment.

Hope u understand

7 0
3 years ago
Other questions:
  • A particular neutral uranium atom has 92 protons, 143 neutrons, and an atomic mass of 235. how many electrons does the atom have
    10·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • NEED HELP PLEASE ANSWER LOTS OF POINTS!!!!!!!!!!!11
    9·1 answer
  • WILL GIVE BRAINLIEST!!!
    15·2 answers
  • According to Craik and Lockhart (1972), the three levels of processing are __________, _________, and _________.
    5·2 answers
  • The maintenance of homeostasis a. involves using material culture to make living possible in certain settings. b. involves the s
    14·1 answer
  • What process is responsible for creating magnetic changes along mid-ocean ridges
    11·1 answer
  • I still dont understand life lol
    6·2 answers
  • Which of the following statements does NOT accurately describe difference between mitosis &amp; meiosis? A.mitosis is used to pr
    13·1 answer
  • Akeem cut his finger during an investigation, and it is bleeding slightly. Before helping him bandage the wound, which precautio
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!