1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artyom0805 [142]
1 year ago
7

Which of the following BEST describes the spatial pattern of MOST cultural regions? (5 points)

Geography
1 answer:
Westkost [7]1 year ago
5 0

According to question, cultural regions have firm easily delineated boundaries.

Option D is correct .

Each cultural region is unique due to its language, religion, government, use of the land, education system, and customs. Geographers recognize the Middle East, Latin America, North America, Europe, Russia, Sub-Saharan Africa, China, Japan, South Asia, and Southeast Asia as some of the major cultural regions in the world today.

Historically, internal characteristics that convey a sense of place have been used to define regions. Whether a region is formal, functional, or vernacular, their boundaries change depending on the type; each has a distinct meaning and intended use.

To know more about cultural regions visit :

brainly.com/question/14466751

#SPJ1

You might be interested in
Why is it important to study the atmosphere in relation to air pollution
wariber [46]
<span>Atmospheric pollution has drastic effects on the health and well-being of people, plants, and animals on Earth.

</span>
3 0
4 years ago
Which mountain range separates Georgia from Russia? Ural Mountains Carpathian Mountains Caucasus Mountains Siberia Mountains
Anvisha [2.4K]
<span>Caucasus Mountains separates Georgia from </span>Russia<span />
3 0
3 years ago
What risks could there be in having the vast majority of a country’s agricultural production dependent on one crop?
notsponge [240]

Answer:

Explanation:

According to a new WWF book, agriculture – the largest industry in the world – is one of the biggest threats to the environment. Inefficient food production and harmful agriculture subsidies are causing deforestation, water shortages and pollution.

6 0
2 years ago
Read 2 more answers
About snowing,it has snowed in my place for years but this year it's really not happening..What do you think about this?
Svetllana [295]
Although global human impact (global warming) is not to be ignored, this is mainly because of the El Nino in the <span>central and eastern equatorial Pacific Ocean.
 
If you're in the Eastern USA, its messing with the jet stream the high/low pressure ridges, causing the cold front to not be within the Northeastern USA area this year.

If you're in other areas far enough I don't know, global warming?


</span>
4 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • Analyze the map below and answer the question that follows.
    6·2 answers
  • Select statements true of fracture zones. Choose one or more: A. Earthquakes can occur along fracture zones. B. Fracture zones a
    10·1 answer
  • The sun .......... energy into<br> space.
    9·1 answer
  • Who are the 2 senators for California and when did they become our senators
    13·1 answer
  • what is the weaker,hotter zone beneath the lithosphere that allows motion of Earths rigid outer shell
    15·1 answer
  • Why Are there tents im the mountains of azad kashmir
    10·1 answer
  • Why doesn’t the sun blow itself up?
    11·1 answer
  • Identify the Andes<br> C С<br> DB<br> F<br> E
    5·1 answer
  • Which type of nation has benefited the most from the Green Revolution and why?
    15·1 answer
  • Which phrase best completes the diagram​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!