1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Karo-lina-s [1.5K]
10 months ago
12

E transformation step in creating bacteria genetically engineered to produce human proteins involves?

Biology
1 answer:
andre [41]9 months ago
8 0

E transformation in creating bacteria genetically engineered to produce human proteins.

Small, single-celled organisms called bacteria exist. Nearly all areas of the world are home to bacteria, which are essential to their ecosystems. Some species can survive in environments with high pressure and temperatures. The average person's body is teeming with bacteria, and it's thought that bacterial cells outnumber human cells. The bacteria that hurt us are the bad ones.

They are known as pathogens. These might be picked up from our surroundings. Vibrio cholera, the bacteria that causes cholera, can be obtained through consuming food or water that has been tainted with an infected person's feces, as well as by coming into direct touch with an infected person.

To learn more about bacteria please visit-
brainly.com/question/8008968
#SPJ4

You might be interested in
The first experiment to produce "protocells" came from compounds found where?
masya89 [10]
B. i guess ! don’t mind this brainly told me to put 20 characters.
6 0
2 years ago
Can muscle fatigue be attained with short repetitive contractions in a 5 minute period?
DENIUS [597]

Answer:

Muscle fatigue is a common complaint in clinical practice. In humans, muscle fatigue can be defined as exercise-induced decrease in the ability to produce force.

Explanation:

8 0
3 years ago
The natural means by which filoviruses infect humans is __________.
grigory [225]
<span>The means is unknown. Filoviruses are known for causing hemorrhagic fever in humans. However, once a human is infected, passing the virus from person-to-person is the means by which others become infected. Most especially is the transmission through infected bodily fluids or objects that have been unsterilized and come into contact with those fluids.</span>
4 0
3 years ago
How does the environment affect the way of life in a community?
Advocard [28]
Jobs. Like a snow blowing company. They would not have that in Puerto Rico. But Canada might. Because they have a different enviornment.
6 0
3 years ago
Read 2 more answers
HELPPP MEEEEE!!!!!!!!!!!!!111
Sergio039 [100]

Answer:

Group A

Explanation:

4 0
2 years ago
Read 2 more answers
Other questions:
  • 1. metal moderate ability to conduct heat and electricity; solid at room temperature; reacts with other elements 2. nonmetal gas
    13·1 answer
  • During which stage of postmortem decomposition do the muscles stiffen and then relax initial decay
    8·2 answers
  • The corn we eat today is larger and has more
    10·1 answer
  • How does the addition of salt or sugar help preserve food?
    12·1 answer
  • Which of the following is not a compound? A. Water B. Gold C. Sugar D. Salt
    8·2 answers
  • Name of the german scientist from the 1800's that studied animals
    12·1 answer
  • What is the main idea of this text?
    12·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • How is zero, oxidation numbers, and noble gases related​
    11·1 answer
  • Please HELP!!!!!!!! 50 pts!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!