1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iVinArrow [24]
2 years ago
6

Green plants, algae, and certain bacteria are all part of which trophic level

Biology
1 answer:
babunello [35]2 years ago
3 0
The answer is: Producers.

The first trophic level belongs to producers. Producers are organisms able to produce their own food. They are autotrophs. Green plants, algae, and certain bacteria produce their own food using photosynthesis or, in some exceptions, chemosynthesis. Therefore, they are all part of producers (the first trophic level).
You might be interested in
Complete the sentence using the correct term.
Maksim231197 [3]

Answer:

Cloning technology

Explanation:

With cloning technology we can replicate and combine different genes to study, save lives, and create new species

3 0
3 years ago
Fill in the blank: <br><br> The 5’ end of DNA has the ______ sticking out towards the bone
STALIN [3.7K]
Is this the structure of DNA?
3 0
1 year ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
The chemical that promotes phototropism is _____.
san4es73 [151]
During phototropism, the plant hormone auxin<span> controls cell elongation.</span>
7 0
3 years ago
Read 2 more answers
What kinds of scientific investigations do not involve observations
Eduardwww [97]
All science involves observation.
4 0
2 years ago
Other questions:
  • Imagine that the climate in your region became extremely arid, and freshwater became a scarce and precious resource. Wasteful us
    6·1 answer
  • True or false the blue radius is perpendicular to the green chord
    5·2 answers
  • DNA replication occurs prior to meiosis and _________. mitosis cytokinesis transcription 2. Adenine with Thymine and Cytosine wi
    13·1 answer
  • What are two ways nitrogen can get into the ground?
    6·1 answer
  • The main difference among the four soil types is the size of the grains (particles) that make up the soil.
    7·1 answer
  • Why does an increase in temperature result in an increase in reaction rate?
    10·2 answers
  • Which line from Chaucer’s “General Prologue" to The Canterbury Tales is a reference to the feudal social structure of medieval E
    12·1 answer
  • Describe how water is important to plants in terms of hydrolysis and dehydration
    14·1 answer
  • What do the following results from the TEST FOR LIFE tab indicate about the sample?
    7·1 answer
  • Do copd sufferers die of respiratory causes or other causes?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!