1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helen [10]
3 years ago
12

A nurse in a well-child clinic is collecting data on children for scoliosis screening. which child is at greatest risk for scoli

osis?
Biology
1 answer:
STatiana [176]3 years ago
3 0
Those children who present the signs of a scoliosis in the inspection of the trunk are: asymmetry of height of shoulders, prominence of one of the scapulae and asymmetry of the flank with prominence of one of the iliac rims. To optimize the identification of these aspects, the examination should be done only with underwear.
You might be interested in
Which of the following takes place in the light-dependent reactions of
Fantom [35]

Answer:

b) Energy is Captured.

The sunlight is converted to chemical energy

go for it!!

5 0
2 years ago
Write the complimentary strand of DNA A C G T C C G A
dlinn [17]

Answer:

T G C A G G C T

Explanation:

3 0
3 years ago
Read 2 more answers
Cerumen is produced by glands located in the
borishaifa [10]
Stratum corneum is the answer
4 0
3 years ago
What are tsunamis and how are they formed?
Alika [10]
A long high sea wave caused by an earthquake, submarine landslide, or other disturbance. Undersea earthquakes, which typically occur at boundaries between Earth's tectonic plates, cause the water above to be moved up or down. Tsunami waves are formed as the displaced water, which acts under the influence of gravity, attempts to find a stable position again.
7 0
3 years ago
Read 2 more answers
PLEASEEEE HELPPP MEE ASSSAP IF YOU CAN PLEASEEE!!!! Describe the differences between all three types of population dispersion (r
kolezko [41]

Answer:

  • Random dispersion occurs with dandelion and other plants that have wind-dispersed seeds that germinate wherever they happen to fall in a favorable environment.
  • Clumped dispersion is seen in plants that drop their seeds straight to the ground, such as oak trees, or animals that live in groups, such as schools of fish or herds of elephants.
  • Clumped dispersions may also result from habitat heterogeneity. If favorable conditions are localized, organisms will tend to clump around those, such as lions around a watering hole.

hope this helped you (ㆁωㆁ)

3 0
3 years ago
Other questions:
  • Males account for between _____ and ______ percent of all eating disorders.
    10·1 answer
  • A nurse is assisting a patient with ambulation. the patient becomes short of breath and begins to complain of sharp chest pain.
    6·1 answer
  • Which statement best describes lactic acid fermentation?
    5·1 answer
  • A checkpoint in the cell has broken down. Which of the following results is possible?
    10·1 answer
  • ATP and glucose are both molecules that organisms use for energy. They are like the tank of a tanker truck that delivers gas to
    11·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which statement is true about chloroplasts?
    9·2 answers
  • plz help me u have to match the word with the defineition BRAINLIESTTTTTTTT and u must do all of them or u will get reported
    6·2 answers
  • Photosynthesis requires light, water, carbon dioxide, and light absorbing <br> ______.
    7·2 answers
  • Life sciences about gaseous exchange please help.​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!