1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nana76 [90]
2 years ago
8

How did brown test his hypothesis

Biology
1 answer:
Aliun [14]2 years ago
7 0

Answer:did it yuehehfiuhufhiufwhufhuihuihfjkjfhufbvfiurvbuib

Explanation:fghufuhfushfshuihsufdh

You might be interested in
At the beginning of meiosis, humans
Misha Larkins [42]
I’ll go with ccccccccccc cc
5 0
3 years ago
There are six elements that make up 99.9% of the human body. which one is responsible for most of the material found in teeth?
il63 [147K]
I believe that is calcium. 
3 0
2 years ago
Señalen las diferencias entre los siguientes pares de términos:
vagabundo [1.1K]

Answer:

amalicias y lipasas

d esa es

Explanation:

d

8 0
2 years ago
Which statement best describes the interdependence of photosynthesis and cellular respiration?
densk [106]

Answer:

C.

Explanation:

Photosynthesis: reactants are CO2 and H20

products are O2 and Sugar

Cellular respiration: reactants are O2 and Sugar

products are C02 and H20

so they are swapped

5 0
2 years ago
Which of the examples below is an example of oppression apex?
egoroff_w [7]

Answer:

The answer is other people assuming that you are in a gang

Explanation:

3 0
3 years ago
Other questions:
  • 15 points
    13·1 answer
  • ​physiologically, ptsd appears to be related to damage to
    11·1 answer
  • The common edible frog of europe is a hybrid between two species
    7·1 answer
  • The following diagram shows a stage of a cell during mitosis. Two identical circles are joined in the middle and they have the n
    7·1 answer
  • Which of the following statements is/are consistent with the fluid-mosaic model of membranes? (Select all that apply.) The lipid
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Why do scientists dispute the claim that the Loch Ness monster is a real creature?​
    6·1 answer
  • Genes are specific sections of?​
    13·2 answers
  • Which statement best explains the process of cellular respiration?"
    12·1 answer
  • Partial nitrate reduction results in the formation of.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!