1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anni [7]
3 years ago
7

There are 2 types of crust - Continental and Oceanic. True False

Biology
2 answers:
Artist 52 [7]3 years ago
7 0

Answer:

true

Explanation:

cuz it's true also trust me I've done my research.

Anastaziya [24]3 years ago
4 0

Answer: True

Explanation: Earth's crust is generally divided into older, thicker continental crust and younger, denser oceanic crust. The dynamic geology of Earth's crust is informed by plate tectonics.

You might be interested in
How does an octopus move without having a single bone in it's body?
-BARSIC- [3]
Octopus<span> muscle fibers run in all directions; when contracted, they form a "skeletal" support system.</span>
6 0
3 years ago
How does Kinetic energy and how does it relates to diffusion and temperature.
Molodets [167]
Kinetic energy is energy which a body possesses by virtue of being in motion and it relates to diffusion and the temperature of a substance is related to the average kinetic energy of the particles of that substance. It relates to diffusion because each collision aids in the diffusion of a substance within a gas or liquid. Yw , mark me brainlist please :)
5 0
3 years ago
Read 2 more answers
Explain why different gametes produced by the same person can have different combinations of alleles for two genes that are loca
aniked [119]
The different combination of alleles for two genes must be due to "Crossing Over"  [ Process occurs after fertilization, inter-changing of characters ]

Hope this helps!
7 0
3 years ago
Read 2 more answers
The function of the DNA instructions in the body cells of an organism is to
Vladimir [108]
Determine what traits you get :)
4 0
3 years ago
Read 2 more answers
Define osmoregulation​
Marina86 [1]

Answer:The regulation of osmotic pressure of an organisms body fluids.

3 0
3 years ago
Read 2 more answers
Other questions:
  • A mitosis inhibitor is a medication that is designed to prevent mitosis in certain cells. why would these be helpful in the trea
    6·1 answer
  • You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
    8·1 answer
  • How are prokaryotic cells and eukaryotic cells different?
    12·2 answers
  • The use of non-local resources is associated with certain economic and environmental consequences.
    7·2 answers
  • Which of the following best describes the result of meiosis II?
    13·2 answers
  • Muscle cells would contain a high number of
    8·2 answers
  • Convert the temperature 49 degrees celcius to kelvin
    15·1 answer
  • sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
    7·1 answer
  • Why does all energy in a food chain flow to bacteria?
    6·2 answers
  • Specialised Plant cells are used to absorb water from the soil.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!