1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiks02 [169]
4 years ago
5

How does sodium bicarbonate affect the rate of photosynthesis

Biology
1 answer:
NeTakaya4 years ago
6 0
<span>gas production also meant a doubling in the rate of photosynthesis? ... By adding a number of equal volumes of normal sodium bicarbonate solution the concentration of carbon dioxide available to the plant is increased and the gas production measured. Prior knowledge. Sodium hydrogencarbonate is a source of carbon dioxide.</span>
You might be interested in
Soil is a combination of tiny rock fragments and decayed plant materials. How do you think soil helps a plant
strojnjashka [21]
The dirt and fragments decompose and give the plant proteins/nutrients. Soil also anchors roots down and provides some water
6 0
4 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
The “box” part of a box-and-whisker plot represents __________.
Inga [223]
<span>quartile values..................</span>
5 0
4 years ago
Someone plz help me :(
Alexeev081 [22]
The answer to the question is B
4 0
3 years ago
Read 2 more answers
Why is it necessary for green plants to carry out both photosynthesis and respiration?
finlep [7]
To survive and to reproduce
6 0
3 years ago
Read 2 more answers
Other questions:
  • Of the 3 types of rocks, which type is most likely to contain fossils? explain.
    8·1 answer
  • An astronomer wrote down the following observations regarding an object she recently discovered. Which piece of evidence disqual
    8·2 answers
  • Mental dysfunction in an elderly person may seem like a normal part of aging, but it can result from disease or another cause. w
    7·2 answers
  • n electron micrographs of HSV infection, it can be seen that the intact virus initially reacts with cell-surface proteoglycans,
    10·1 answer
  • The absence of ______ in the primitive atmosphere was essential to the origin of life on Earth.
    12·1 answer
  • Los grupos radicales dan identidad a los aminoacidos
    14·2 answers
  • Why would we never run out of carbon dioxide is not carbon
    5·1 answer
  • Marking PEOPLE AS BRAINLIST <br><br> what is the purpose of mitosis
    6·1 answer
  • When things are difficult in your course and you are having trouble what resources can you use to help you find the answers?
    9·1 answer
  • What are the weather conditions in an area of low pressure?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!