1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
never [62]
3 years ago
13

Which of these statements best describes the relationship between matter, pure substances, and mixtures?

Biology
1 answer:
Marianna [84]3 years ago
5 0
A, i think, not too sure 
You might be interested in
list three characteristics that are used to describe a population (ANSWER QUICK AND I'LL MARK BRAINLIEST)!
olya-2409 [2.1K]
Living, populated, and thriving
6 0
3 years ago
Which of the following is not an example of potential energy?
denis-greek [22]

Answer:

:v

aaaaaaaaa

Explanation:

7 0
3 years ago
Read 2 more answers
What is the one way nitrogen may be returned to the air?
jenyasd209 [6]

Answer:

Nitrogen in its gaseous form (N2) can’t be used by most living things. It has to be converted or ‘fixed’ to a more usable form through a process called fixation. Biologically: Nitrogen gas (N2) diffuses into the soil from the atmosphere, and species of bacteria convert this nitrogen to ammonium ions (NH4+), which can be used by plants.

Explanation:

5 0
3 years ago
Read 2 more answers
What type of energy does X most likely represent? A gravitational energy, b gravitational energy, c thermal energy, d radiant en
liberstina [14]

Answer:

d.

Explanation:

Radiant energy is electromagnetic energy that travels in transverse waves. Radiant energy includes visible light, x-rays, gamma rays, and radio waves. Light is one type of radiant energy. Sunshine is radiant energy, which provides the fuel and warmth that make life on earth possible.please mark brainliest

3 0
3 years ago
Read 2 more answers
Study methods according to Psychology?
Softa [21]

Answer:

Study actively, not passively. Think critically and deeply about the material. ...

Remember the hindsight bias. ...

Remember the overconfidence effect. ...

Use the self-reference effect. ...

Sleep. ...

Take up to a ten-minute break every hour. ...

Some tips for effective textbook studying:

Always take notes on the textbook chapters.

Explanation:

that is the answer

3 0
3 years ago
Other questions:
  • Predict the most likely observed level of luciferase activity if plasmid pCDγ3-789 is introduced into nonlymphoid cells such as
    13·1 answer
  • Pick the group of elements with the most common characteristics
    13·1 answer
  • 3) Once cells with nuclei developed, organisms were able to become more complex, which allowed them to adapt to the conditions i
    12·2 answers
  • Besides plants what 2 other types of organisms experience plasmolysis
    10·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The extracellular matrix is thought to participate in the regulation of animal cell behavior by communicating information from t
    13·1 answer
  • As a plant cell what extra layer must be formed in the onion to separate the daughter cells?​
    9·1 answer
  • What do organs combine to form?
    5·2 answers
  • NEED HELP ASAP!!!! Explain why the fact that invasive species did not co-evolve with the native species unbalances an ecosystem.
    15·2 answers
  • In cellular respiration, glucose __________ electrons, whereas __________ electrons.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!