1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fittoniya [83]
4 years ago
6

10 POINTS!

Biology
1 answer:
olga55 [171]4 years ago
6 0

Answer:

It is an everyday life theory because it is not supported by evidence.

Explanation:

This is something not supported by evidence there were no humans around to tell us today from way back then.

You might be interested in
What does an epidemiologist study?
Lerok [7]
Patterns incidence distribution and possible control of diseases as well as other factors pertaining to health
7 0
3 years ago
Are muscles organs? (please give me a yes or no answer with an explanation, im confused ;v;)
Igoryamba
A whole skeletal muscle is considered an organ of the muscular system. From a sample response:)
8 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What causes changes in air pressure in the atmosphere
harina [27]

Answer:

Air pressure is caused by the weight of the air molecules above

Explanation:

Air pressure is caused by the weight of the air molecules above. Even tiny air molecules have some weight, and the huge numbers of air molecules that make up the layers of our atmosphere collectively have a great deal of weight, which presses down on whatever is below.

5 0
4 years ago
Is there a term for water's ability to bend around objects? (For example, how water, like any liquid, will curve around a rock t
Sav [38]
Viscosity refers to the speed at which a substance can flow (i.e. the thickness of the substance/its ability to flow). I think that's the closest the English language gets. 
8 0
3 years ago
Other questions:
  • A force that causes an object to change its motion is called?
    6·1 answer
  • Which condition must you meet in order to measure your resting heart rate
    13·2 answers
  • PLEASE HELP BRAINLIEST AND 27 POINTS!!
    11·2 answers
  • In the combined processes of glycolysis and cellular respiration, what is consumed and what is produced?
    11·1 answer
  • Two organisms that occupy many of the same niches are most likely
    10·1 answer
  • The study of nutrients in food and in the body is referred to as nutrition and is sometimes called the study of human behaviors.
    7·1 answer
  • Suppose you traveled back in time and located the first animals to have evolved feathers. You found that these animals were tree
    11·1 answer
  • By substitution, justify that x= − 6 is a solution to x − 2 = − x − 14
    9·1 answer
  • The application of scientific knowledge to the interest of humans is called.
    5·1 answer
  • Why would scientists analyze another specimen from the same species
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!