1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lady_Fox [76]
3 years ago
8

The cardiovascular system delivers nutrients and oxygen to all cells in the human body. Your heart is the pump that drives blood

flow throughout your body. There are specific factors that can affect blood flow through the cardiovascular system.out such factors.
Read the statements below and determine which are true about such factors.

A high viscosity of blood causes an increased resistance in the blood vessels and leads to slow blood flow.

A low blood pH decreases the rate of diffusion through the blood vessels and leads to slow blood flow.

As people age, plaque builds up in the arteries increasing vessel resistance, which leads to disease.

The factors that most directly affect blood flow are blood pressure, blood volume, resistance and activity level.

As people age, blood pressure decreases leading to more cardiovascular disease.
Biology
2 answers:
Archy [21]3 years ago
7 0

The factors that most directly affect blood flow are blood pressure, blood volume, resistance and activity level.

true

Kitty [74]3 years ago
3 0

A high viscosity of blood causes an increased resistance in the blood vessels and leads to slow blood flow.

As people age, plaque builds up in the arteries increasing vessel resistance, which leads to disease.

The factors that most directly affect blood flow are blood pressure, blood volume, resistance and activity level.

You might be interested in
Which of the following mutations could lead to constitutive expression of the genes of the lac operon? View Available Hint(s) Wh
Molodets [167]

Options for part A are as follows:

A) A mutation in the operator sequence

B) A mutation in the lac-Z gene

C) A mutation in the lac-Y gene

D) A super repressor mutation

Answer:

The correct answer:

Part a - A mutation in the operator sequence

Part b - It ensures that a cell dedicates resources to the production of enzymes involved in lactose metabolism only when lactose is available in the environment

Part C. true.

Explanation:

part a:

If there is a mutation in the operator sequence leads to prevent binding of the repressor which leads to allowing constitutive expression of the genes various conditions.

part b:

The biological role of the lac operon makes sure that the cell dedicates resources to the production of enzymes involved in lactose metabolism only when lactose is available in the environment

Part c:

RNA polymerase cannot transcribe the structural genes due to the repressor binds to the lac operator, therefore, the proper function of the lac operon is possible when the placement of the operator sequence between the promotor and the structural genes.

4 0
3 years ago
1. The diagram below represents a cell and several
Ray Of Light [21]

Explanation:

(3) active transport

The molecules would be moving against their concentration gradient from a region of low concentration to a region of high concentration.

While cells facilitate the transport of molecules via movement across the cell membrane, there many different mechanisms. These include passive diffusion, facilitated diffusion,  and passive transport. However some very large molecules require specialized type of active transport, which requires energy in the form of ATP, in order to move substances across the membrane against their concentration gradient.

Active transport is a mediated process that requires an energy input and the use of specialized membrane proteins to move against the concentration gradient. These proteins require energy in the form of adenosine triphosphate or ATP in order to facilitate necessary conformational changes to the large protein molecules to alter the spatial location of the molecule. For instance, with Na+, K+ pumps in cell membranes.

Learn more about membrane components at brainly.com/question/1971706

Learn more about plasma membrane transport at brainly.com/question/11410881

#LearnWithBrainly

8 0
4 years ago
Dissolved waste in the blood is filtered by?
vagabundo [1.1K]
The kidneys remove dissolved waste in the blood 

Hope this helps!

8 0
4 years ago
In ATP, which bond is broken when energy is released and when energy is added which bond forms?
Marrrta [24]
Energy is released from ATP by the breaking of the phosphate bond. A<span>denosine triphosphate, or ATP, consists of a sugar called ribose, the molecule adenine and three phosphate groups. During the hydrolysis of ATP, the last phosphate group is transferred to another molecule, thus breaking the phosphate bond. This reaction causes energy to be released to power other activities within the cell.</span>
5 0
4 years ago
Which is a kingdom? <br><br> a. plantae<br> b. mollusca<br> c. mammalia<br> d. Athropoda
White raven [17]

Answer:

mammalia

Explanation:

did the test

3 0
3 years ago
Other questions:
  • What part of the midbrain influences the activity of the entire nervous system what part of the midbrain influences the activity
    11·1 answer
  • A scientist concludes that a population of bison has reached the carrying capacity of the prairie where it lives. The birthrate
    6·1 answer
  • What is the greatest risk of death worldwide?
    12·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Dr. landen is performing an experiment to determine if a new chemical that he has synthesized is effective at killing plated col
    5·1 answer
  • Which of the following are books of the minor prophets?
    6·2 answers
  • Plants appear green because they do not absorb the green wavelengths of light what happens to those green light waves when they
    15·1 answer
  • What is taken
    12·1 answer
  • Which statement is correct about rough ER and smooth ER?
    12·1 answer
  • HELP ASAP THANKS + explain!! - will mark brainiest :).
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!