1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denis23 [38]
3 years ago
11

How would you buffer a solution that has a pH of 12

Biology
1 answer:
Zarrin [17]3 years ago
4 0
If by buffer you mean dilute or cancel out a 12 ph level is a base so you need to add the equal and opposite amount of acid to it....kind of like how -1+1=0

hope this helps im learning about this too!
You might be interested in
How does a scientist come up with a theory?
Tatiana [17]

Answer:

A scientific theory is an explanation of an aspect of the natural world that can be repeatedly tested and verified in accordance with the scientific method

Explanation:

3 0
3 years ago
Read 2 more answers
Neurotransmission is unidirectional insofar as chemical and electrical conduction is concerned within the individual neuron. Of
jasenka [17]

Answer: The correct option is C (Dendrites, Cell body, Axon, Axon terminals)

Explanation:

The transfer of information from neuron to neuron takes place through the release of chemical substances into the space between the axon and the dendrites. These chemicals are called neurotransmitters, and the process is called NEUROTRANSMISSION.

The order of neurotransmitter/receptor interaction that results in an electrical signal impulse and the release of another neurotransmitter for interaction in the synaptic cleft (signal conduction through a neuron) is from Dendrites--> Cell body--> Axon-->Axon terminals>

DENDRITES extends from the cell body of a neurone to receive messages at neuromuscular junction from other neurons. The CELL BODY directs all activities to the axon. The AXON is a long single fibre that transmits messages from the cell body and ends in terminals forming a synapse. Nerve impulses arrives at the axon terminal causing the release of neurotransmitters. The neurotransmitters binds to receptors at the dendrites of another neurons. The electrical signal impulses generated causes the release of neurotransmitters in another neuron.

8 0
3 years ago
Which statement best describes the importance of carbon in the atmosphere?
Bogdan [553]

Answer:

The answer is c because A and B are not really giving off an imporant feeling to why carbon is important and D if you read the question carefully it says abundant which means to be a lot of, so C would be your answer

and plus i did the test

Explanation:

8 0
3 years ago
Read 2 more answers
The actual niche the organism is able to occupy in the presence of competitors is called its:_____________.
ladessa [460]

Answer:

B) realized niche

Explanation:  

The ecological niche refers to all the environmental factors that influence the growth, survival, and reproduction of species. These factors also include the interaction between species. The term ecological niche refers to the fundamental niche or the realized niche.    

  • The fundamental niche refers<u> only</u> to factors or physical conditions under which a species can live and survive in the <u>absence of any interaction with other species. </u>
  • The realized niche refers to the restricted conditions in which a species can live and survive as a result of <u>environmental conditions and the interaction with other species</u><u>. </u>

When an inferior competitor is excluded by the superior competitor, this is known as competitive exclusion. This occurs when there is not habitat differentiation, and both species can not share the same niche. In this case, the effective or realized niche of the dominant species completely occupies the fundamental niche of the inferior competitor.        

 In the exposed example the organism is able to occupy a niche in the presence of competitors, which is the clue for us to classify this niche as a realized niche. The organism needs to interact in a certain way with its competitors. There is an interaction between taxonomic groups, or between individuals.

6 0
3 years ago
A pituitary hormone that stimulates the interstitial cells to secrete testosterone?
kakasveta [241]

The pituitary hormone that stimulates the interstitial cells to secret testosterone is <u>LH </u><u>[</u><u>Luteinizing </u><u>H</u><u>ormone</u><u>]</u><u>.</u>

6 0
2 years ago
Other questions:
  • Describe two advantages of genetic engineering. (4 points)
    9·2 answers
  • What is Fibrocartilage
    15·1 answer
  • Explain the process that creates wind
    9·2 answers
  • Which statement describes a research finding that demonstrates the functional lateralization of the brain that is involved in la
    13·1 answer
  • On Earth, old matter is recycled into new matter.<br><br><br> True <br> False
    5·2 answers
  • Water and the Earth 1:Question 3
    7·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Plz help me I am timed
    6·1 answer
  • Creating a Bottleneck Effect in an Ostrilope Population in the Sim
    15·1 answer
  • All the following are good sources of complex carbohydrates except? oatmeal. milk. carrots. spinach.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!