1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
2 years ago
5

What is the mRNA in TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Softa [21]2 years ago
3 0

Answer:

AUGGCCUACGGUCUAGUUUAG

You might be interested in
What is produced by a plant as a result of photosynthesis?
hammer [34]

Answer:

I think its glucose

Explanation:

5 0
2 years ago
Read 2 more answers
What is the answer to these two questions
kotegsom [21]

Answer:

4.B

5.C

Explanation:

8 0
2 years ago
What are cells that express the same genes? A. The same B. Differentiated C. Mutated D. Not living
goblinko [34]
The answer would be A
6 0
3 years ago
Read 2 more answers
Cholesterol is a component of cell membranes and is an example of which type of lipid?.
Lisa [10]
Cholesterol is a component of cell membranes and is an example of steroid
8 0
2 years ago
Reduced options for males can lead to a inbreeding? Species diversity or genetic diversity
larisa [96]
The answer to this is genetic diversity. Genetic Diversity is the total number of genetic makeup of a species. It distinguished from genetic variability, which describes the tendency of genetic characteristics to vary.  <span />
8 0
3 years ago
Other questions:
  • You have a culture of yeast that is at a concentration of 6.74 x 10^6 cells/ml. You dilute the sample 1:100, and then 1:100 agai
    12·1 answer
  • 1. electrons lowest energy position of an electron in an atom 2. neutron packet of energy of specific size 3. photon neutral sub
    7·2 answers
  • Please help me for 10 points
    8·1 answer
  • How does population growth negatively impact water quality?
    5·2 answers
  • The most common phenotype in a natural population is referred to as the
    14·1 answer
  • A. What is the probability a person admitted to the hospital will suffer a treatment-caused injury due to negligence (to 2 decim
    14·1 answer
  • It is common knowledge that elephants are deathly afraid of mice. What is not so common knowledge is the reason why. Clearly it
    9·1 answer
  • 14. Which of the following may produce more than one functional protein
    12·1 answer
  • Please help asap brainliest<br> links will be reported
    8·1 answer
  • A forensic scientist is trying to find out the number of adenine bases in the DNA sample that he obtained from a crime scene.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!