1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
2 years ago
5

What is the mRNA in TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Softa [21]2 years ago
3 0

Answer:

AUGGCCUACGGUCUAGUUUAG

You might be interested in
A team of scientists conducted a study of grassland ecosystem and estimated the total energy at each trophic level. Their data i
maria [59]

Answer:

In grassland ecosystem, first trophic level is the producer. Producers are the organisms which makes their own food, here the producer are grasses. The second trohic level contain herbivores which feed on these grasses. These herbivores are eaten by secondary consumers which belongs to third trophic level and secondary consumers are then eaten by tertiary consumer.

The population of producers are very high so it is placed at the base while tertiary consumer are placed on the top due to low population.

8 0
2 years ago
What do frozen water drops become when they are carried back up into the sky by the wind and more layers of ice form on them?
Morgarella [4.7K]
The answer would be C. Hail.
3 0
3 years ago
A substance that releases hydrogen ions in water is a base.<br> a. True<br> b. False
Vlada [557]
It is true, it does release hydrogen ions in a water base.
8 0
3 years ago
Read 2 more answers
A hormone released by the _____ controls the amount of calcium in the blood. thymus gland thyroid gland adrenal glands parathyro
noname [10]
The answer is the parathyroid glands
6 0
2 years ago
What effect might obesity have on blood pressure? Does obesity alone cause a person to be at risk for high blood pressure? What
Ugo [173]

Answer:

obesity increases blood pressure

Explanation:

This is because the high fat percentage in the body has lead to a build up of fat on the inside of arteries and this makes them thinner. the heart has to pump harder to get the blood around the body and through these, now smaller arteries. therefore yes having diabetes does increase blood pressure.

other factors which increase blood pressure are high stress levels, smoking, anxiety.

6 0
1 year ago
Other questions:
  • The preferred way to remove moisture from a dust cap prior to putting it back in place is to:
    14·1 answer
  • How does the number of chromosomes in a daughter cell compare to the number of chromosomes in a parent cell?
    7·1 answer
  • You visit Antarctica on a cold, breezy morning as part of an exploration mission to save the Polar bears. Your team sees a polar
    5·1 answer
  • What are the uses of the whorls of the flower ​
    12·1 answer
  • What are the three types of counseling established by marine corps policy?
    13·1 answer
  • In a flowering plant, gene "A" encodes an enzyme responsible for the presence of dots on the flowers’ petals. A1, A2, and A3are
    10·1 answer
  • When measuring for pH, you are measuring for the presence of these ions?
    15·1 answer
  • How is E.coli like a paramecium?
    6·2 answers
  • It is the sequence of nucleotides in our DNA that makes each one of us unique. Specifically, it is the sequence of nucleotides i
    6·2 answers
  • Help me with this question please !!!
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!