1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
3 years ago
5

What is the mRNA in TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Softa [21]3 years ago
3 0

Answer:

AUGGCCUACGGUCUAGUUUAG

You might be interested in
What is not true about landslide
Cerrena [4.2K]
Is this a multiple choice question if so can you please type them down
4 0
3 years ago
Read 2 more answers
Drugs deemed to have the highest potential for abuse and having a current medical use are listed in which schedule of the Contro
Andrew [12]
Schedule 2 drugs are considered to have the highest potential for abuse and psychological dependence while having a medical use.
3 0
3 years ago
Which organ does not play a role in mechanical or chemical digestion
coldgirl [10]

brain is the organ which does play a role in mechanical or chemical digestion

4 0
3 years ago
Jessica isn't invited to a super bowl party her coworkers are throwing because she's a woman. jessica is experiencing ____ from
Dahasolnce [82]
The answer is A. Discrimination

I hope this helps!
8 0
3 years ago
Read 2 more answers
This one is easy<br>please help : )​
Afina-wow [57]

Answer: D- Last quarter moon

7 0
3 years ago
Read 2 more answers
Other questions:
  • What is the source of energy for photosynthesis
    7·1 answer
  • Fermentation is another name for which type of respiration
    13·2 answers
  • ______ have reproductive structures known as fruiting bodies.
    8·2 answers
  • How does the tympanic membrane work? please help need answer quick. Thank you.
    12·1 answer
  • What layer of the earth are tectonic plates located
    8·1 answer
  • How many radians are in 160°
    13·1 answer
  • Heat moves from the land to the air through the process of
    11·1 answer
  • ​The foodborne infection that is most commonly a result of eating contaminated eggs or poultry is caused by: Group of answer cho
    7·1 answer
  • Guys pls help me!!!!!!!!!!!
    13·1 answer
  • Please Help!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!