1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
2 years ago
5

What is the mRNA in TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Softa [21]2 years ago
3 0

Answer:

AUGGCCUACGGUCUAGUUUAG

You might be interested in
All of the following best describes how does pollution affect a food web except?
LUCKY_DIMON [66]
I believe it’s D. Secondary consumers eat plants, if i remember correctly.
6 0
2 years ago
Read 2 more answers
Pls help !! Ill give brainliest !
Vedmedyk [2.9K]
1 goes with d
2 goes with c
3 goes with b
4 goes with a
5 goes with e
6 0
2 years ago
A cactus with long spines protects itself from animals better than a cactus with short spines. According to natural selection, _
worty [1.4K]
<span>Long-spined cacti will survive longer and reproduce more often than short-spined cacti</span>. Because natural selection suggests that organisms with certain traits that give them better chance at survival or reproductive rate will be pass on to their offspring.
7 0
3 years ago
Read 2 more answers
The Sun is best described as...
faust18 [17]
Gass in the atmospere 

4 0
3 years ago
Read 2 more answers
2-In what way is nitrogen important to life on Earth?
Anna007 [38]
I believe all of the above!
8 0
3 years ago
Read 2 more answers
Other questions:
  • Alan observed that a lot of soil from his garden swept off from after heavy rain. Which is this process called? A.groundwater re
    9·2 answers
  • Joe was observing an embryo with 16 cells.what is a 16-celled enbryo called?
    6·1 answer
  • For uv region absorption, which light source will be used? a. mercury lamp b. deuterium lamp c. tungsten-halogen lamp d. none of
    11·1 answer
  • (BRAINLY FOR CORRECT ANSWER, PLEASE HELP)
    12·1 answer
  • What is the energy source that feeds a thunderstorm?
    8·1 answer
  • In active transport, this is a cell transport (biology) question, what are the two main characteristics?
    7·1 answer
  • Amino acid catabolism involves the breakdown of 20 amino acids all of which contain nitrogen but have different carbon skeletons
    5·1 answer
  • Respiratory system, circulatory system, what stuck, digestive system, and how do they work together?
    9·2 answers
  • Cómo se genera la luz y el calor que irradia el sol?
    9·2 answers
  • Study the picture of the imaginary animal below. Based on its features, make scientific inferences about the animal's habitat an
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!