1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
3 years ago
5

What is the mRNA in TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Softa [21]3 years ago
3 0

Answer:

AUGGCCUACGGUCUAGUUUAG

You might be interested in
Explain why people with emphysema suffer from shortness of breath​
Alex
Because Theyr lungs don’t get enough air they are supposed to
6 0
2 years ago
What is different between plant and animals
ycow [4]
The difference between plant and animals is that plants take carbon dioxide while animals breathe in that oxygen and breathe back out carbon dioxide
5 0
1 year ago
Under normal conditions, when cells are not in contact with other cells this will signalthem to divide. When cells are too close
Nitella [24]
A. external
These types of signals are observed when there is a cut on the body. The epidermal cells lose contact with one another and divide faster until they are in contact once again. After they come into contact, division slows down again.
7 0
3 years ago
Read 2 more answers
Pls fast
strojnjashka [21]

Answer:

The correct answer is - disrupting microtubule assembly and proper formation of the mitotic spindle and the kinetochore.

Explanation:

Vinblastine is known for treating cancer cells by sending them to apoptosis. It interferes with the synthesis of microtubules. It binds to the microtubular proteins of the mitotic spindle that causes disrupting microtubule assembly.

It also prevents from proper formation of the mitotic spindle and the kinetochore which is essential to separating chromosomes during anaphase. They arrest mitosis and cause cell death.

7 0
2 years ago
(13) Can someone help me please?
Volgvan
Dude i think it the calven cycle

7 0
3 years ago
Other questions:
  • Select the incorrect statement.
    5·1 answer
  • Most archaeal cell walls consist of ____; most bacterial cell walls consist of a polymer of peptides and polysaccharides.
    9·1 answer
  • King George III's government was an example of what type of government
    12·1 answer
  • Can someone help me please
    12·1 answer
  • Is chlorophyll a lipid
    9·1 answer
  • Infer how an organism, like a polar bear, might interact with each of earth’s 5 spheres.
    10·1 answer
  • When a nurse uses information from other sources to help rethink revise and apply knowledge to a clinical situation- information
    13·1 answer
  • When bacteria make their own food they are called
    14·1 answer
  • Which of the following statements about fluid pressure is correct?
    10·2 answers
  • Why does the sky change colors at sunset?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!