1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
2 years ago
5

What is the mRNA in TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Softa [21]2 years ago
3 0

Answer:

AUGGCCUACGGUCUAGUUUAG

You might be interested in
19. The energy that animals need for their life functions is released when their cells carry out which of the following function
Strike441 [17]

Answer:

B

Explanation:

During cellular respiration in most animals and plants, oxygen reacts with carbon containing molecules (sugars) to provide energy to cells of the organism. the flow of energy in organisms.

5 0
2 years ago
Scientists use many resources to piece together the history of life on Earth. The fossil record is one source of information tha
astraxan [27]

Answer:

See explanation

Explanation:

Fossil records contain an extensive detail of the evolution of various species on earth which have been preserved in the remains of these organisms or imprints that organisms that existed long ago must have left  in sedimentary rocks.

Fossil records basically tell us about the past. They tell us about the species that once existed on earth. They also tell us how long these species existed and how the were related to other species.

This information help us to work out how these organisms lived and the environment where they lived.

4 0
3 years ago
1. Describe how radio telescopes are used to explore space.
Yuri [45]

Radio telescope picks up the radio spectrum of electromagnetic waves from celestial bodies (just like telescopes like the Hubble pick up visible light – only that radio waves are invisible to our eyes). They are therefore used to detect objects in space that produces radio waves. Examples are quasars and pulsars. Radio telescopes also enable astronomers to be whats beyond gas and dust in space that blocks out most of the visible light spectrum.

8 0
3 years ago
Read 2 more answers
Science biology hw please help fast
Anuta_ua [19.1K]

Answer:

A. is palisade mesophyll

B. is spongy mesophyll

EXPLANATION OF PALISADE MESOPHYLL

  • Palisade cells are found in the mesophyll of a leaf and their main function is the absorption of light so that photosynthesis can take place.
  • The palisade mesophyll consists of chloroplasts with chlorophyll that absorb the light energy
  • The mesophyll layer is made up of the palisade cell and spongy parts. #answerwithquality #BAL

8 0
3 years ago
When a negatively charged object moves in the opposite direction of an electric field, the potential energy of the object?
Ostrovityanka [42]

Decrease is the correct answer.

3 0
2 years ago
Read 2 more answers
Other questions:
  • Plz help me!
    7·2 answers
  • What must occur for a message to be sent from the outside of the cell to the inside?
    7·2 answers
  • How do neurofibrils differ from nerve fibers?
    7·2 answers
  • What was the great dark spot on neptune?
    15·1 answer
  • What must happen before meiosis can begin
    12·2 answers
  • A farmer is trying to increase the diversity of corn kernel color in his crops. The trait for corn color is controlled by two al
    9·1 answer
  • Label the parts of the Enzyme-Substrate Complex<br> A-<br> B-<br> C-<br> D-<br> E-
    10·1 answer
  • PLEASE HELP ME WITH THIS
    5·1 answer
  • Think about the process of cellular respiration. While there are several products of
    15·2 answers
  • what determines which individuals will survive and which will not? help me please I hate biology so much
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!