1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
2 years ago
5

What is the mRNA in TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Softa [21]2 years ago
3 0

Answer:

AUGGCCUACGGUCUAGUUUAG

You might be interested in
A recessive gene located on the X chromosome is the cause of hemophilia in affected individuals. Males are more likely to have h
Mice21 [21]
<span>The right answer is D. males have only one copy of the X chromosome.

</span>Hemophilia is a rare hereditary bleeding disorder disease. The blood of hemophiliacs does not coagulate normally. Bleeding is not more important, but without treatment, they can be more frequent and last longer than normal. Hence the importance of good monitoring and good treatment.
<span>The 2 types of hemophilia A and B are recessive and X-linked, but a third of hemophilia correspond to a de novo mutation. It is observed that a man who wears the X is always affected by the disease (because he has only one X chromosome in its genome) whereas the woman is only a carrier (she has two X chromosomes, so it can carry a safe X and a mutated X without being attempted by the disease but can transmit it to her descendants). This must be taken into account for genetic counseling.</span>
7 0
3 years ago
Blood flow
horrorfan [7]

Answer:

D. Tricuspid → right ventricle → pulmonary valve → pulmonary circulation

Explanation:

The circulatory system is the system of organs and blood vessels which is associated with the circulation of the blood in the body.

The circulatory system is divided into two portions: the systemic circulatory system (body) and the pulmonary circulatory system (lungs).

The vena cava brings the oxygen-poor blood from the body to the right atrium from where the blood is transferred to the same side of the ventricle controlled by the tricuspid valve (atrioventricular valve).

From the right ventricle, the blood is pumped to the pulmonary artery which transports the blood to the lungs where the oxygen will be exchanged.

Thus, Option-D is correct.

4 0
3 years ago
After the swim meet, many cheeseburgers were eaten by a swim team of hungry kids.
xxTIMURxx [149]

Answer:

Lol! Also, what is the question? Or is there no question?

Explanation:

4 0
2 years ago
How does an organism's niche differ from its habitat?
mars1129 [50]

Answer:

An organisms niche is it's role in the ecosystem. This includes what it eats and what it's eaten by, and is usually affected by it's habitat.

An organisms habitat is simply where the organism lives.

6 0
2 years ago
Which statement is true about natural selection?
Alik [6]

Answer:

I would say B

Explanation:

Because atural selection is the mechanism for how evolution occurs over time. Basically, natural selection says that individuals within a population of a species that have favorable adaptations for their environment will live long enough to reproduce and pass down those desirable traits to their offspring.

8 0
3 years ago
Other questions:
  • If skeletal muscles work to the point of fatigue, the muscle cells may not have sufficient oxygen to carry out aerobic respirati
    7·1 answer
  • Find the area o o
    13·1 answer
  • Describe what would happen to people who lost their mitochondria and explain why it would happen. Are there any "backup systems"
    11·1 answer
  • Describe 3 different ways that antibodies inactivate antigens
    5·1 answer
  • What is food called when it initially enters the stomach?<br>-Anatomy: digestive system
    13·2 answers
  • During early developement all cells in the embryos of a multicellular organism are identical. Later in developement the cells be
    9·1 answer
  • Natural selection can occur as a result of...
    11·2 answers
  • Which method of heat transfer is what caused the green house effect on earth
    11·1 answer
  • The movement of water<br> from bodies of water to the<br> atmosphere
    14·1 answer
  • Russell and Marco are trying to lift their friend Colin onto a tree branch. Russell is pushing
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!