1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
3 years ago
5

What is the mRNA in TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Softa [21]3 years ago
3 0

Answer:

AUGGCCUACGGUCUAGUUUAG

You might be interested in
An example of human systems that work together to provide nutrients for the cells and tissues is
Ad libitum [116K]

Answer:

The answer is C

3 0
4 years ago
A cell is a complex system. Like most systems, a cell contains a boundary that separates things that are inside the system from
bearhunter [10]

Answer;

Cell membrane


A cell membrane acts as a boundary that separates things that are inside the system from those that are outside the system.

Explanation;

It is a thin semipermeable structure that surrounds the cytoplasm of a cell.

The membrane functions to protect the integrity of the internal environment of the cell by allowing selective movements of materials in and out of the cell.

The membrane consists of a phospholipid bilayer with proteins embedded in it.

6 0
3 years ago
Read 2 more answers
How do forensic scientists determine the time of death? There are timely pieces of evidence that help scientists with this task.
Norma-Jean [14]
  1. the cells start to die
  2. the heart stops
  3. the skin gets tight and grey
  4. the muscles relax
  5. and then the bladder and bowels empty
3 0
3 years ago
Trisomy 21 can be caused by nondisjunction of chromosome 21, or by inheriting a Robertsonian fusion of chromosome 21 attached to
OLga [1]

Answer:

6 in total; 3 viable and 3 non-viable

Explanation:

Robertsonian translocation is one of the types of structural alteration in chromosomes, in other words, a rearrangement between chromosomes, which can occur between five pairs of acrocentric chromosomes (chromosomes with the centromere close to the end of one of the "arms"): 13, 14, 15, 21 and 22.

An individual who has Robertson's translocation between chromosomes 14 and 21 generally has only 45 chromosomes.

In addition, a carrier of this type of translocation can theoretically produce 6 types of gametes, however 3 of them are not viable.

As for the three remaining gametes: One is normal, and among the other two, one is balanced and the last is unbalanced.

So, theoretically, when combining a normal gamete, the probability of a child with down syndrome being born through these conditions is 1/3 (considering that the probability of producing a certain type of gamete is equal for the three types).

3 0
3 years ago
¿que necesita una teoría para que sea valida?
AURORKA [14]

Answer:

la teoría debe ser la precisión de las predicciones que debe producir

8 0
3 years ago
Read 2 more answers
Other questions:
  • What did you observe when you mechanically stimulated your retina? what you learned from lecture explains the observation?
    12·1 answer
  • The chimpanzee and the bonobo population were separated by the congo river; therefore the groups could not reproduce with each o
    15·1 answer
  • If you wanted to learn more about the genetic material of plant and animal cells, where would you look?
    6·2 answers
  • Humans can hear echolocation of bats, as they try to find food in the night sky.
    10·1 answer
  • Select the correct statement regarding adipose tissue.
    6·2 answers
  • Which scientist disproved the ideas of spontaneous generation
    15·1 answer
  • Newborn infants that are exposed to nitrate poisoning are said to be suffering from also known as .
    11·2 answers
  • Which of these is NOT a type of fungi?<br><br> yeast<br><br> mold<br><br> algae<br><br> mushrooms
    15·1 answer
  • Ashton is a crime scene investigator. He ensures that all the evidence gathered at the scene is properly handled and labeled. Wh
    14·1 answer
  • During the cell cycle, proteins called cyclins bind to enzymes that send signals for the cell to progress through stages of cell
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!