1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
3 years ago
5

What is the mRNA in TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Softa [21]3 years ago
3 0

Answer:

AUGGCCUACGGUCUAGUUUAG

You might be interested in
The protoplasm and cytoplasm of a plant are interchangeable terms. <br> a. True <br> b. False
expeople1 [14]

B. False

Protoplasm- includes the nucleus
Cytoplasm- excludes the nucleus
6 0
3 years ago
Read 2 more answers
What height setting of the first hill will cause the 35 g car to reach the egg in 1.88 s?
Butoxors [25]
35g car to reach on egg in 1.88 sec.
 

Its easy 40 because to add and divide.
3 0
3 years ago
Write in a full paragraph explain how water supports life on earth. Provide eveidence for why you think so
Savatey [412]

<span>Firstly, it is the only substance on Earth that is in liquid form at the temperatures commonly found on the Surface of our planet. Secondly, it is a superb solvent, meaning that other substances regularly and easily dissolve into it. This allows water to carry nutrients to cells, and carry waste away from them.</span>
8 0
3 years ago
As an air mass cools, water will condense when:
ddd [48]
The answer is A. Dew point is the temperature at which air will turn into water vapor, a state between gas and liquid. If the temperature is further cooled down to lower than the dew point, water will condense, in other words, the gas state of air will turn into liquid state of water.
7 0
3 years ago
Read 2 more answers
1.What’s the name for excessive bodily hair growth in women?
AleksandrR [38]
1.Hirsutism

2. Seven

3. SeaHorses
7 0
3 years ago
Read 2 more answers
Other questions:
  • Why is a classroom door knob the least infected place in a classroom?
    10·1 answer
  • How is the density of ocean water affected by temperature and water?
    15·1 answer
  • Suppose you eat fatty cheeseburger at a 4th of July picnic. In order for your body to use the fat molecule, it must first be mix
    6·2 answers
  • In eukaryotic nuclei, DNA and proteins are packaged into organized cellular structures known as _______.
    10·2 answers
  • The study of the ways living things function.
    5·2 answers
  • Which of the following holds true for energy coupling?
    13·2 answers
  • Why do some cells appear in one type of cell but not in another ?
    5·1 answer
  • What is natural selection?
    8·2 answers
  • Which type of cell is pictured on the right?<br> V eukaryoticy<br> COMPLETE
    6·1 answer
  • Tell me an operational definition for each underlined idea. You can do one, but the more you do the more points you get. Thank y
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!