1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
3 years ago
5

What is the mRNA in TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Softa [21]3 years ago
3 0

Answer:

AUGGCCUACGGUCUAGUUUAG

You might be interested in
What is the reproductive system? Explain in detail.
Nikolay [14]
The reproductive system is a group of sex organs that work together for the purpose of sexual reproduction. Hope this helped! 
5 0
3 years ago
Read 2 more answers
The polar head of a phospholipid is made of _______ molecules. phosphate protein fatty acid carbohydrate
Maksim231197 [3]
The polar head of a phospholipid is made of phosphate. The polar head has a negative charge that is made up of phosphate molecules. This polar region attracts water and is positioned outward to interact with the water. 

I hope this helps!
3 0
3 years ago
Read 2 more answers
while observing an elodea plant cell through a microscope a student noticed a small moving greendisk these organelles are most l
Drupady [299]
Answer:  "photosynthesis" .
________________________________________________________
<u>Note</u>:  These small, moving "green disks" seen while observing an <em>Elodea</em> plant cell—under a microscrope— are "chloroplasts".   The "chloroplasts" are organelles that ar responsible for "photosynthesis" .
_________________________________________________________
6 0
3 years ago
Please HELP!!!!!!!! 50 pts!
Thepotemich [5.8K]

Answer:

I think that Viruses are not alive so Being composed of molecules that are found in cells (nucleic acids, proteins, lipids and complex sugars) and having the capacity to evolve, viruses are often said to be alive. But they aren't alive because they arent a living thing.

6 0
2 years ago
What is Simple Diffusion​
Snowcat [4.5K]

Answer:

is a state of matter from a lower concentration to a higher concentration

5 0
3 years ago
Read 2 more answers
Other questions:
  • Lydia hypothesizes that warmer temperatures promote faster cell division. Which experimental design would best allow Lydia to te
    11·2 answers
  • Which of the following would be the SI unit to use in measuring the amount of electrical current in a circuit?
    12·2 answers
  • What is the uses of nuclear power?
    9·1 answer
  • 1.
    6·1 answer
  • What do you believe must be done to feed 9 billion people?
    9·1 answer
  • Arrange the levels of biological classification from broadest to most specific.
    5·1 answer
  • The process of DNA replication occurs just before ______________.
    15·1 answer
  • what can you infer about how cell division in a normal cell compares to cell division in cancerous cells?​
    14·1 answer
  • Which process requires cellular energy?
    12·2 answers
  • How did changes in earth's atmosphere allow for the evolution of life on earth?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!