1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
3 years ago
5

What is the mRNA in TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Softa [21]3 years ago
3 0

Answer:

AUGGCCUACGGUCUAGUUUAG

You might be interested in
A postitivly charged atom has? A.Lost electrons B. Lost protons C.Gained electrons D.Gained protons
Kipish [7]

Not to be too picky, but the question ought to say a positively charge ion rather than atom.

I will assume that is what you mean. An ion, using ordinary means, will be positive if it loses electrons (which are negative).

An ion can never gain protons. Left alone, the nucleus will remain unchanged for the rest of eternity. D is wrong.

C is wrong. If electrons are gained, the ion will go negative.

B is wrong for the same reason D is. An ion can't gain protons and it can't lose them.

A is the answer.

6 0
3 years ago
5. Thermal pollution is caused by excess
romanna [79]

Answer:

B radioactive

Explanation:

6 0
3 years ago
Transcribe DNA sequence GGTCAATGCCATAAG into mRNA
ZanzabumX [31]

Answer:

What does GGTCAATGCCATAAG into mRNA mean?

Explanation:

3 0
3 years ago
On average, those with the short form of the ____ transporter gene and a history of stressful experiences reported more than ave
astraxan [27]

Answer:

serotonin

Explanation:

Here is the complete question:. on average, those with the short form of the ________ transporter gene and a history of stressful experiences reported more than average symptoms of depression.

Serotonin is sometimes called the happy chemical, because it contributes to wellbeing and happiness. The scientific name for serotonin is 5-hydroxytryptamine, or 5-HT.

6 0
3 years ago
Read 2 more answers
How do Eukaryotic and Prokaryotic cells use cell structures to perform a specific function within an organelle?
Molodets [167]
Yes the aryotic Parts play posific parts
4 0
3 years ago
Other questions:
  • Make sure to enter all cell reference in upper case when putting them in formulas.
    10·1 answer
  • A scientific experiment is repeated, but its results cannot be repeated by others. What can you conclude about the experiment?
    9·1 answer
  • 7. ) Most of a cell's growth and activity occurs in the ______ phase.
    12·1 answer
  • At high elevations respiratory rate will
    8·1 answer
  • ANSWER QUICK PLEASE I have to turn in today thx.
    8·1 answer
  • How are meiosis and mitosis similar?
    8·1 answer
  • During cytokinesis, the cell membrane ________ until two daughter cells separate completely.
    5·1 answer
  • All the genes in a particular living organism are called its:
    7·1 answer
  • In reindeer, a black nose (B) is dominant to a red-glowing nose (b). A male with a red-glowing nose and a female who is heterozy
    5·1 answer
  • The outer cortex of the brain contains the cell bodies of cerebral neurons and known as gray matter. true false
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!