1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
3 years ago
5

What is the mRNA in TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Softa [21]3 years ago
3 0

Answer:

AUGGCCUACGGUCUAGUUUAG

You might be interested in
How often does the body perform cellular respiration?. A.once in the morning and once at night. B.only at night. C.continuously.
Arturiano [62]
The body actually performs cellular respiration continuously. The correct option among all the answers that are given in the question is the third option or option "C". The other options that are given are wrong and so can be avoided. I hope the answer has actually come to your help.
5 0
3 years ago
Read 2 more answers
Which statement best describes the relationship of photosynthesis and energy?
Afina-wow [57]

Answer:

The correct answer is The process of photosynthesis is energy storing because the process converts light energy into chemical energy which stored in the bonds of glucose.

Explanation:

During photosynthesis the light harvesting complexes absorb sunlinght and transfer that light energy to the reaction centre of photosystem.The photosystem then converts the light energy into chemical energy in form of ATP.

      The ATP molecules are used along with NADPH to form glucose in the dark reaction of photosynthesis.

7 0
3 years ago
Read 2 more answers
In humans and other multicellular organisms, which substance plays a central role as an
AlladinOne [14]

Explanation:

Carbohydrates are the main energy source of the human diet. 

Fats are also a source of energy but fats are the slowest source of energy.

3 0
3 years ago
An object with a mass of 20 kg and potential energy of 584 J is what distance above the ground
grigory [225]

Answer:

29.2 m

Explanation:

P=mh. Plug in the values.

584 J = 20 kg x <em>h</em>

h = 29.2 m

If it's gravitational potential energy multiply is by gravity which I think is 10 m/s.

8 0
2 years ago
The central portion of Earth is called<br> core<br> crust <br> mantle<br> moho
Vinil7 [7]
The central portion of Earth is called the CORE
8 0
3 years ago
Read 2 more answers
Other questions:
  • Why are mammals more closely related to birds than to amphibians?
    6·1 answer
  • BRAINLIESTTT ASAP!!!
    15·2 answers
  • In which condition the substrate have faster diffusion rate
    7·1 answer
  • An igneous rock that contains mostly plagioclase feldspar and about 30 percent dark silicate minerals has a composition that is
    10·1 answer
  • Ecological Succession in order
    7·1 answer
  • What human activity contributes to air pollution?
    6·2 answers
  • The main function of the respiratory system is to
    14·2 answers
  • Hii! giving out 15 points + brainly to ppl! hope everyone has a good day reading this &lt;3
    8·2 answers
  • water enters a long vurvykar tube at a eman tempreture taht is lower than the tine surface temperatire. The curve that most clos
    14·1 answer
  • If you’re looking at tissue samples, how can you determine if there is cancer? What are some visual differences?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!