1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
3 years ago
5

What is the mRNA in TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Softa [21]3 years ago
3 0

Answer:

AUGGCCUACGGUCUAGUUUAG

You might be interested in
What are the impacts of that process of production
Lelu [443]

Answer:

Lack of distinctive advantage in product performance and price.

Over estimation of the target market which may result in low demand.

Inability to utilize company strength to capture profitable opportunities.

Unpredictable change in consumers preference for goods and services.

Negative Effects of Production on Environment and Society. It leads to the pollution of the environment (environmental pollution) It leads to erosion as a result of big holes created by construction industries.

Explanation:

hope this helps you, sorry if it is not what you are looking for.

7 0
2 years ago
Identify the general location of the zygomatic arch.
Lesechka [4]

Answer:

Identify the general location of the zygomatic arch. cheek. The zygomatic arch is a bony bridge formed between the zygomatic and temporal bones. ... The temporal process of the zygomatic bone and the zygomatic process of the temporal bone fuse to form the zygomatic arch.

Explanation:

possible

answer

4 0
3 years ago
What does homeostasis means in biology?
diamong [38]

A relatively constant internal physical and chemical conditions that organisms maintain.

5 0
4 years ago
Read 2 more answers
Two grizzly bears are fighting over a fish to feed themselves. what kind of interaction is this scenario, which works as a limit
faust18 [17]

Answer: The correct answer is- Intraspecific competition.

Intraspecific competition can be described as an interaction in a population where members belonging to the same species compete for a limited resource ( such as food, water).

As per the information given in the question, both organisms ( grizzly bears) belong to the same species and competing for fish, which is food for them.

Thus, it is an example of Intraspecific competition.

 


3 0
3 years ago
Read 2 more answers
can someone please explain to me how to do this along with an example? will be giving brainliest if you help :)
Rainbow [258]

Answer:

Whether matter exists as a solid, liquid or gas is determined by the arrangement of its particles and the strength of attraction between the particles.  The three states can be easily distinguished because of their physical properties.  

A physical property is a characteristic of matter which can be observed without any chemical change to the matter (shape, volume, colour, smell etc.). A chemical change is one in which new substance are formed.  

Explanation:

Solids have <u>a fixed volume and shape</u>. They also vibrate in a fixed position. Ice

Liquids have <u>do not have a fixed shape but a definite volume</u>. They take the shape of their container. They are able to move past each other by allowing the liquid to flow. Water

Gases <u>do not have a fixed shape or volume</u>. Particles take up the space of the container they are in. Particles move freely and rapidly. Water vapour

*my gas picture isn't sending sorry

3 0
3 years ago
Other questions:
  • Suppose a drug is developed that blocks K+ leakage channels. The drug prevents ions from passing through those channels. If this
    8·1 answer
  • Because the amazon pink dolphin is in danger of extintion <br> it is urgent
    5·1 answer
  • How does polymerase chain reaction make DNA fingerprinting more reliable
    7·2 answers
  • Explain the law of conservation of energy
    7·2 answers
  • An asynchronous culture is given 3H-thymidine for a period of time, usually about 30 minutes. During the labeling period, 42% of
    7·1 answer
  • Which phrase describes the policy that guided how the British ruled the American colonies during most of the colonial period?
    8·1 answer
  • Darwin developed his theory of natural selection only from his work on the Galapagos Islands.
    7·1 answer
  • Can I turn my cat into a diamond once it passes away?
    9·2 answers
  • Strawberries are exceptional fruits to use for DNA extraction because they have huge genomes. Strawberries are octoploid, what d
    8·1 answer
  • In recent times, we now know tectonic plates move and cause continents to separate and collide over many years. Given this fact,
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!