1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Genrish500 [490]
3 years ago
6

The nucleus of an atom contains

Biology
2 answers:
Verdich [7]3 years ago
7 0
The nucleus of an atom contains the protons and the neutrons.
Rudiy273 years ago
4 0
The nucleus of an atom contains both protons and neutrons. Protons have a positive charge and neutrons have no charge.
You might be interested in
A vegtable garden is 12 meters long by 7 meters wide. In one square meter, you count two toads. Estimate the population of toads
marysya [2.9K]

Answer:

168 toads

Explanation:

First we need to find the area of the garden. Area = length x width

Area = 12m x 7m = 84 m²

2 toads/ 1 sq m

84(2) = 168

6 0
2 years ago
Read 2 more answers
What new sentence come up to help remember the eigth planets in order​
seropon [69]

Can you retype this in> I don't understand exactly what you're trying to ask.

6 0
4 years ago
Read 2 more answers
30? POINTS (APEX)
olga nikolaevna [1]

I think it should be A

3 0
3 years ago
Read 2 more answers
An male animal has a genotype of AaBB. The number of different gene combinations that would be found in the sex cells/sperm of t
kvv77 [185]

Answer:

B

Explanation:

Using a Punnett Square, you find that the outcomes are AB, AB, aB, and aB. There are only two unique genotypes here, so the answer is 2.

8 0
3 years ago
Some (blank) transport materials into and out of the cell.
padilas [110]
The answer is c, lipids, :)
7 0
3 years ago
Read 2 more answers
Other questions:
  • By what process does nitrogen enter the living components of ecosystems?
    7·1 answer
  • What is a consequence of the specific heat capacity for liquid water, ice and water vapor
    8·1 answer
  • What do cells have a plasma membrane please!
    14·1 answer
  • Normal cell division in the body depends on a precisely regulated set of events that determine when a cell will divide. two spec
    8·2 answers
  • The ________ essentially aids in cellular homeostasis by providing the main transport mechanism for proteins within the cell.
    13·2 answers
  • 11. Look at the figure above. Which atmospheric layer has around 80 percent of the mass of the earth's atmosphere? (Hint: It's w
    6·2 answers
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • Say OINKITY OINK FOR BIG BRAINILEST REEEEEEE
    5·2 answers
  • if an organism shows the dominant trait, can you tell just by looking at what its genotype is? and why
    13·1 answer
  • Which of these is believed to be a cognitive process? A. Sociocultural Theory B. Social Learning C. Theory of Psychosocial Devel
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!