1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
victus00 [196]
3 years ago
7

Are boys or girls more likely to abuse androgenic steroids.

Health
1 answer:
padilas [110]3 years ago
6 0
My parents told me it would be boys
You might be interested in
Join this g o o g l e meet : https://m eet.g o o g l e.com/xad-vaag-kid
inessss [21]

Answer:

bet

Explanation:

7 0
3 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
Give three reasons why as the population increases, careers in Family and Community Services increase.
Nady [450]

Why hello there

Why should you or for a fact why do people do community services?

Here are three main reasons why according to my opinion!

  • While doing community services many people gets touched in life and understand the true meaning of community services. So in another phrase " Community Services makes a really big impact"!
  • Community services makes a segnificent job growth. According to many studies on Community Services, researchers how found that citizens or even anyone is this planet who is involved is community services has i higher chance of understanding there jobs and the jobs are growing meaning there are new and new jobs each day for someone so no one is left behind!
  • One of teh best parts of community services is that who cares how old you are whether your young or even a old man its ok. In Community services the goal is to help peopel understand the true meaning of working in Community services it can start from picking up litter to making new medicine.

IMPORTANT: If my answer helped please mark me as brainliest thank you and have the best day ever!

-Mnadat9

7 0
3 years ago
Why the Affordable Care Act failed?
Serga [27]

Since the Affordable Care Act's passage on March 23, 2010, health parity in the US has advanced in a historic way. All Americans' health, including that of women and families, children, older people, individuals with disabilities, LGBTQI+ people, and communities of colour, improved as a result of this historic law.

The Affordable Care Act includes tax provisions that affect individuals, families, businesses, insurers, tax-exempt organizations, and governmental agencies in addition to comprehensive health insurance changes. Important changes are made by these tax provisions, including how people and families submit their taxes. The Patient Protection and Affordable Care Act, also known as the Affordable Care Act or Obamacare, is a historic piece of U.S. federal legislation that was passed by the 111th Congress and was signed into law by President Barack Obama on March 23, 2010. It marks the largest regulatory revision and coverage extension to the American healthcare system since the passage of Medicare and Medicaid in 1965, along with the adjustment made by the Health Care and Education Reconciliation Act of 2010. The majority of the ACA's provisions went into effect in 2014. By 2016, there were an estimated 20 to 24 million more individuals having insurance, which resulted in the percentage of the population without insurance approximately halving. A number of delivery system improvements were also put into place by the law with the goal of lowering costs and raising standards in healthcare. Following its implementation, rises in healthcare costs as a whole—including insurance premiums for employer-based plans—slowed.

Learn more about Affordable Care Act here

brainly.com/question/26495011

#SPJ4

3 0
1 year ago
Most victims of sex trafficking and prostitution have been coerced into these ways of living.
strojnjashka [21]
It can be true or false most of the time people get into sex trafficking because they have been forced to do that stuff before like get raped or sexually a abused by someone you love and trust or some stranger you didn’t knows at all at the time. Depends on the circumstances but more than likely it is going to be that it had been done to them before so they are doing it.
7 0
4 years ago
Read 2 more answers
Other questions:
  • Physical training that includes short intense burst of activities such
    7·2 answers
  • What forms the respiratory membrane
    15·1 answer
  • Closing an orifice partial is called
    14·1 answer
  • Duration refers to the amount of time of your aerobic session. true or false.
    11·2 answers
  • Which methods helps prevent communicable disease?
    9·2 answers
  • 1. cual es la ciudad capital de costa rica​
    10·1 answer
  • You press on the carotid artery in your neck and begin counting. What are you most likely measuring? A. blood flow B. blood pres
    14·2 answers
  • Why . . . ?<br><br><br><br> ANSWER: . . .
    9·1 answer
  • You should use the principle of rest and recovery when training for muscular strength and only complete these workouts two or th
    9·1 answer
  • The unit informs us that many people disregard chakras because you cannot see or feel them. Do you agree with this line of think
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!