1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artist 52 [7]
3 years ago
6

In what phase i co2 produced in cellular respiration

Biology
1 answer:
VladimirAG [237]3 years ago
4 0
1st stage, also known as the Krebs cycle, also know as the citric acid cycle
You might be interested in
The term for the role a organisms has in the community
Vinvika [58]
Each organism has a job in a community
4 0
3 years ago
How is blood different after it is pumped through the capillaries in the intestines?
kumpel [21]

Answer:

B

Explanation:

7 0
3 years ago
Medications that block the reuptake of serotonin will thereby increase the concentration of serotonin molecules in the select on
Feliz [49]

The answer is Synaptic gaps

5 0
3 years ago
Darwin was the first to provide convincing arguments and evidence to evolution.<br> True<br> False
Whitepunk [10]
False, Darwin was just the most famous one to do it.
5 0
3 years ago
Within this body part, lymph acquires particles that help the _______ system function.
ElenaW [278]

Within this body part, lymph acquires particles that help immune system function. According to Merriam dictionary, immune system is defined as “the bodily system that protects the body from foreign substances, cells, and tissues by producing the immune response and that includes especially the thymus, spleen, lymph nodes, special deposits of lymphoid tissue (as in the gastrointestinal tract and bone marrow), macrophages, lymphocytes including the B cells and T cells, and antibodies.”

<span> </span>

8 0
3 years ago
Other questions:
  • More than thirteen million children around the world die each year of pneumonia, diarrhea, measles, tetanus, whooping cough, and
    6·1 answer
  • What are storage proteins
    9·2 answers
  • 6. To survive, populations of organisms must be able to __<br> offspring
    11·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Why is water molecule called polar
    14·1 answer
  • Analyze: The yellow ring inside the bacterial cell represents the bacterial DNA. Why does this structure disappear by step 3 of
    14·1 answer
  • WHICH CHARACTERISTICS DO ALL MINERALS HAVE IN COMMON? PLEASE HELP ITS FAST
    9·1 answer
  • What is the purpose of RNA Translation
    6·1 answer
  • Helpppppppppppppp my friend needs it
    12·1 answer
  • In general, the higher the intensity of exercise, the greater the contribution of:______
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!