Answer;
Oxygen or an oxidizing agent to receive electrons must be present for oxidation to occur in chemical reactions.
Explanation;
Oxidation entails the loss of electrons from these molecules, causing them to become unstable and highly reactive and leading to their eventual reaction with and damage of cell components such as membranes.
-In redox reaction; The ion or molecule that accepts electrons is called the oxidizing agent; by accepting electrons it causes the oxidation of another species. Conversely, the species that donates electrons is called the reducing agent; when the reaction occurs, it reduces the other species.
Answer:
the anwer is distance option a or 1
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Answer: d. High biodiversity in the understory.
Explanation:
The taiga or boreal forests are the largest biome in the world. These can be found in the regions of North America, Alaska, and United States. These regions exhibit extreme weather conditions. Typically long winters and moderate to high precipitation. The soil is permafrost and nutrient poor as no new organic matter can be added up to the soil due to it's freezing condition. The plant growth is scanty and biodiversity is low because organisms are incapable of surviving in the harsh weather conditions.
The answer is the letter C i think
