1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sweet-ann [11.9K]
3 years ago
14

How is the water in hydrothermal vents heated

Biology
2 answers:
nadya68 [22]3 years ago
7 0

The answer is:

<u><em>Friction heats the water as it seeps into holes and cracks on the ocean floor. </em></u>

sergij07 [2.7K]3 years ago
4 0
The particles are predominantly very fine-grained sulfide minerals formed when the hot hydrothermal<span>fluids mix with near-freezing seawater. ... The cold seawater is </span>heated<span> by </span>hot<span> magma and reemerges to form the </span>vents<span>. Seawater in </span>hydrothermal vents<span> may reach temperatures of over 700° Fahrenheit </span>
You might be interested in
Energy to drive the formation of atp in photosynthesis is derived from:.
enot [183]

Answer:

They require light, and their net effect is to convert water molecules into oxygen, while producing ATP molecules—from ADP and Pi—and NADPH molecules—via reduction of NADP+. ATP and NADPH are produced on the stroma side of the thylakoid membrane, where they can be used by the Calvin cycle.

Explanation:please give brainliest

4 0
2 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
A group of similar cells that perform a common function
Alchen [17]

Answer:

Tissue

Tissue is the group of similar cells that are common in origin to perform particular function. Tissue system is the group of similar tissues that are common in origin and perform particular function. Organs are made up of tissue system.

Explanation:

4 0
3 years ago
Describe the genetic mutations that you think occurred in the cancer cells that were responsible for the phenotypic differences
Sergeeva-Olga [200]

Answer:

Cancer cells are characterized by mutations associated with the uncontrolled growth of these tumor cells

Explanation:

Mutations in tumor suppressor genes are often associated with different types of cancers. On the other hand, mutations derived from the insertion of Transposable Elements may also activate cancer-related genes which are known as oncogenes

5 0
3 years ago
Blood is transformed into a solid gel when, at the site of vessel damage, plasma ____________ is converted to ____________ , whi
umka2103 [35]
<span>Hemostasis is the process of the body that seals blood vessels that rupture. The process is basically starts with an injury, then vascular spasm, platelet plug formation and then coagulation. 

During blood clot formation, blood is transformed into solid gel at site of damage, where plasma fibrinogen is converted into loose fibrin molecules, which bind together to form mesh. Platelets and blood cells get trapped here by the fibrin strands, which produces a clot. This part of the clot formation is called coagulation. 


</span>
8 0
3 years ago
Other questions:
  • In adaptive immunity if you are exposed to the flu virus while you are out for lunch, what category does that fall in for adapti
    8·1 answer
  • A person sees a ball and kicks it, in part because of actions of the nervous system. Using the parts of the nervous system liste
    12·1 answer
  • If a person's parathyroids are responding properly to a drop in blood calcium, which of the following should result?a.Parathyroi
    13·1 answer
  • What runs along the top of the troposphere
    5·2 answers
  • How many kingdoms did Whitaker have
    8·2 answers
  • Chemical signal released by nerve cells is:
    8·1 answer
  • What's the relationship between photosynthesis and cellular respiration?
    10·1 answer
  • Which process makes it possible for all the major organs of the body to be formed by week 10 of human development?
    5·2 answers
  • Which of the following was true about the experiment conducted by Miller and Urey
    10·1 answer
  • 2.) Imagine that you and your friend are at the beach. You have your chairs and umbrella set up in the perfect spot near the wat
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!