Answer:
<h2>Dense connective tissue.</h2>
Explanation:
This is a type of connective tissue that has fibers, which are composed of collagen. You can refer to the image attached to see the parallel bundles of these collagenic fibers.
So, basically this formations help to forms strong tissue like tendons or ligaments.
They are cerebral ventricles
The right answer for the question that is being asked and shown above is that: "<span>A. they will overcome the deficiency of nitrogen in the soil." T</span>hese legumes enrich the soil is that <span>they will overcome the deficiency of nitrogen in the soil. </span>
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.