1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serga [27]
3 years ago
15

2. What are trilobites and what geologic era are they from? What does a trilobite look like (include an image)?

Biology
1 answer:
Sunny_sXe [5.5K]3 years ago
8 0
I believe that it is form the Paleozoic era 

You might be interested in
Which statement best describes the events responsible for the phase represented by the letter B in the figure?
Gemiola [76]

Answer:

opening of sodium channels

Explanation:

Sodium channels are integral membrane proteins that form ion channels, conducting sodium ions (Na+) through a cell's plasma membrane. Sodium channels are the founding members of ion channel super-family that includes voltage-gated calcium channels, TRP channels, voltage-gated, inward rectifying, and two-pore-domain potassium channels, and cyclic nucleotide-regulated CNG and HCN channels. When the neuron becomes stimulated the voltage gated sodium channels begin to open and the membrane potential begins to slowly depolarizes and sodium enters the cell down its concentration gradient.

8 0
3 years ago
I need help with this question
Ira Lisetskai [31]

Answer:

B

Explanation:

8 0
3 years ago
The closest star to our solar system is the _____.<br><br> Alpha Centauri<br> Sun<br> Northern Star
Illusion [34]

Answer:

Explanation:

true and keep it up

6 0
3 years ago
How does strip cropping slow down rainfall from removing soil?
alex41 [277]

The growing of a cultivated crop (as corn) in strips alternating with strips of a sod-forming crop (as hay) arranged to follow an approximate contour of the land and minimize erosion.

Strip cropping helps to stop soil erosion by creating natural dams for water, helping to preserve the strength of the soil. Certain layers of plants will absorb minerals and water from the soil more effectively than others. When water reaches the weaker soil that lacks the minerals needed to make it stronger, it normally washes it away. When strips of soil are strong enough to slow down water from moving through them, the weaker soil can't wash away like it normally would. Because of this, farmland stays fertile much longer.

The term strip cropping also refers to a method of dry farming sometimes used in areas including parts of the Great Plains of the United States and the Prairies of Canada. To accumulate moisture in these dry areas, cropland is periodically left fallow. Typically, the fallow and planted areas are organized in parallel long, narrow strips that are oriented normal to the prevailing winds, in order to minimize the erosion of soil from the bare fields. Strip farming helps to prevent mass erosion by having the roots of crops hold on to the soil to prevent it from being washed away.

Hope this helps  Its because its really strong soil

3 0
3 years ago
What is the name given to the pair of chromosomes that are the same in
Llana [10]
Mother X
Father X or Y
6 0
3 years ago
Other questions:
  • Mr. Mars Man is an alien, and he will look different for each one of you. In this lab activity, you will be flipping coins to se
    14·1 answer
  • The bone labeled A in the diagram have the same structure.
    14·1 answer
  • The prefix poly means
    6·2 answers
  • One of the main uses of satellites is
    7·2 answers
  • How does overpopulation affect the ecosystem?
    5·1 answer
  • What is one reason that a cell needs to regulate flow across the membrane? (Points : 1)
    14·1 answer
  • Explain the adaptation in plants using cactus as an example​
    11·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Sketch what you observe when examining the onion root tip using the low power lens in the high-power lens. Label to sketches and
    11·1 answer
  • What is a "first quarter" when talking about phases of the Moon? • a fully lit Moon •half of the Moon illuminated •1/4 of the Mo
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!