1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
leonid [27]
3 years ago
11

Allen and andrew both have the same biological parents. Why do they not resemble either of there parents

Biology
2 answers:
taurus [48]3 years ago
6 0
This can be because of their genetics. The siblings may not have inherited their parents looks, but maybe they inherited their grandparents looks, or even their aunts looks. This is all due to genetics. It's sort of the same thing, when two caucasian parents have an african-american child. That would be because somewhere along the family tree someone was african-american. 
Anyways, I hope this helps!

Sonbull [250]3 years ago
3 0

Answer:

C) Each child receives only half of each parent’s genes.

Explanation:

In sexual reproduction, the offspring receives half the genetic information from their mother and half from their father. The offspring so formed will have a different combination of genes from the parents. So, the siblings are not identical to their parents.

You might be interested in
ASAP WILL GIVE BRAINLEST
RSB [31]

Answer:

It's changeable

Before the microscope, Linnaeus classified organisms only separated in two kingdoms, while more were introduced later. So, they were only classified in two kingdoms, they can be changed and  classified to more than  two.

3 0
3 years ago
Read 2 more answers
What do the following two equations represent?<br> 5x +y = 3<br> . 10x + 2y = -6
cupoosta [38]

Answer:

Choose distinct parallel lines.

Explanation:

They represent two parallel lines. The slopes are going to be the same in each line . Put the x value on the opposite side of the equal sign.

y = - 5x + 3           The slope is - 5

10x + 2y = - 6        Subtract 10x from both sides

2y = - 10x - 6         Divide by 2

y = -10x/2 - 6/2

y =-5x - 3

That minus three is the problem. You have 2 different y intercepts. That means that you have 2 parallel lines.

8 0
2 years ago
The soft lining inside of your mouth is an example of
user100 [1]
The oral mucosa is the mucous membrane lining the inside of the mouth and consists of stratified squamous epithelium termed oral epithelium and an underlying connective tissue termed lamina propria
6 0
3 years ago
Read 2 more answers
What is the most common blood type? What is the least common blood type
stiv31 [10]
Hello,

What is the most common blood type?: The most common blood type would be O Positive (O+). About 39 percent of the population has this blood type.

What is the least common blood type?: The least common blood type would be AB Negative (AB-). About 1 percent of the population has this blood type.

Thanks,

-Detector
5 0
3 years ago
Read 2 more answers
Help me its urgent i need help please help me
kogti [31]

The correct matching of the given items are:

  • Omnivore- eats producers and consumers
  • Population- all living and non-living things found in an area
  • Species- a group of living things, more than one organism.
  • Ecosystem- describes a type of organism and what group it belongs to.

<h3>What is an Organism?</h3>

This refers to an individual animal or living thing that is uni-cellular.

Hence, the other answers are:

  • Community- a place where an organism lives and produces its own food.
  • Limiting factors- anything that can limit the size of a population
  • Carnivore- eats herbivores, omnivores and other smaller carnivores
  • Food web: a network of food connected chains that shows a feeding relationship
  • Symbiosis: a close relationship between species including mutualism, commensalism, parasitism

Read more about ecosystem here:

brainly.com/question/4005996

#SPJ1

7 0
2 years ago
Other questions:
  • Which statement is correct? The two tiles are not similar because segment SP is to segment SR is 4 : 7 and segment MJ is to segm
    9·2 answers
  • Can someone please write a 1000 word essay on your opinion on CRISPR
    9·1 answer
  • Which generalization about Earth’s layers can be made based on how the layers were formed?
    11·1 answer
  • Reptiles and birds are divided into two classes, reptilia and aves.Give an example of a fossil evidence that would be the BEST s
    14·1 answer
  • hi how old am i What is the dominant religion in North and South America? A. Islam B. Judaism C. Hinduism D. Christianity Please
    5·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which describes a protein? A. Forms an important part of cell membranes. B. Provides the greatest amount of energy per gram. C.
    13·1 answer
  • 4
    5·2 answers
  • During which stage of mitosis do the sister chromatids split?
    11·2 answers
  • What is genetics? (for science)
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!