1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex_Xolod [135]
3 years ago
10

Which branch of earth science most likely involves the study of climate change and its effect on people?

Biology
1 answer:
Mashcka [7]3 years ago
3 0

Answer:

C. meteorology

Explanation:

meteorology is the scientific study of the atmosphere that focuses on weather processes forecasting, and climate.

You might be interested in
In eukaryotes, extranuclear inheritance occurs when genetic information is transmitted by mechanisms other than through nuclear
Vlad [161]

Answer:

- cpDNA organization is more similar to that of prokaryotes than eukaryotes

- chloroplast chromosomes contain genes that are involved in photophosphorylation

6 0
3 years ago
Which of the following is the Hardy-Weinberg equation?
ohaa [14]
<span>A.)p2 + 2pq + q2 = 1.0</span>B.) p2 + q2 = 1.0 - Correct Answer
<span>C.)p2 + 2pq + q2 = 0</span><span>D.)p2 - 2pq + q2 = 1.0</span><span>E.)p2 - q2 = 1.0</span>
5 0
3 years ago
Read 2 more answers
Endangered species are species with decreasing populations that are
Paraphin [41]

Answer: Sudden loss of habitat

Explanation:

Endangered species are animal or plant species that are in danger of going extinct.

This usually results from them suddenly losing their habitat and thus being exposed to unfamiliar conditions or threats that could end their existence. For instance, elephants losing their forest habitats in India and thus encroaching on farmland only to get shot for damaging farms.

7 0
3 years ago
What are 7 non-examples of Living things?
Pepsi [2]

Chairs, Statues, the road, car, bricks, rocks, and binders

8 0
3 years ago
Which type of epithelium is composed of multiple layers, including an apical layer containing tall, slender cells?
Mademuasel [1]

The question is incomplete as it does not have the options which are:

  • Simple squamous
  • Simple columnar
  • Pseudostratified squamous
  • Stratified squamous
  • Stratified columnar

Answer:

Stratified columnar

Explanation:

Epithelial tissue is the tissue formed by the cells which form a layer of cell and lines the lumen of the organ and also covers the organs. The epithelial tissue can be classified based on the number of layer and shape of the cell.

In the given question, the shape of the cell is slender and are tall therefore are called columnar. The cells form more than one layer or multiple layers therefore form stratified layers.

Therefore,  the epithelial tissue formed by these slender shaped multiple layers is known as the stratified columnar layer. The stratified columnar is present in the respiratory tract and the digestive tract.

Thus,  Stratified columnar is the correct answer.

4 0
3 years ago
Other questions:
  • The best equipped organisms survive true or false
    5·1 answer
  • One section of a strand of dna has the bases sequence agattc. what is the base sequence on the other strand?
    9·1 answer
  • GIVING BRAINLIEST!!! ANSWER ASAP
    9·2 answers
  • How can scientists investigate the impact of limiting factors in an ecosystem?
    5·2 answers
  • Which biome would contain the most biodiversity in deciduous tree species? A. Taiga. B. Savanna. C. Temperate forest. D. Tropica
    7·2 answers
  • Summarize key differences between allopatric and sympatric speciation. Which type of speciation is more common and why? Describe
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which of the following statements about using geothermal energy is not true?
    8·2 answers
  • The red panda is an endangered mammal. Red pandas live in the trees in the forests in China. Explain one way of
    5·1 answer
  • Why can water have no net charge but have slight charges in different parts of the molecule?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!