1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena-s [515]
2 years ago
15

What hominid existed 180,000 years ago

Biology
1 answer:
Ann [662]2 years ago
7 0
An ape existed.......................
You might be interested in
Blood is best classified as connective tissue because _____.
Oxana [17]
D it is found within all the organs of the body
7 0
3 years ago
Read 2 more answers
What is a function of hydrochloric acid in the stomach nutrition?
Mandarinka [93]
The primary role of hydrochloric acid is to sterilize the food you eat and to prevent harmful bacteria from entering the GI tract. HCL also triggers the release of enzymes such as pepsin which are essential for the digestion of protein.
8 0
3 years ago
Which of the following is NOT a characteristic of the northern boreal forest (taiga) biome?
Alik [6]

Answer: d. High biodiversity in the understory.

Explanation:

The taiga or boreal forests are the largest biome in the world. These can be found in the regions of North America, Alaska, and United States. These regions exhibit extreme weather conditions. Typically long winters and moderate to high precipitation. The soil is permafrost and nutrient poor as no new organic matter can be added up to the soil due to it's freezing condition. The plant growth is scanty and biodiversity is low because organisms are incapable of surviving in the harsh weather conditions.

8 0
3 years ago
Reasons why a teenager should not have sex. In a nutshell pls. IS FOR MY HOMEWORK IT'S NOT A JOKE. I report :)
Valentin [98]

Answer:

….

Explanation:

8 0
3 years ago
Read 2 more answers
Terry is teaching his class about atoll reefs. Which of these points should Terry mention in his explanation?
Natasha2012 [34]

Answer:

3

Explanation:

Atoll reefs are generally located in lagoons

6 0
3 years ago
Read 2 more answers
Other questions:
  • Gwen is the mother of newborn Taylor. For the majority of the day, Gwen holds Taylor between her breasts, skin-to-skin. This all
    14·1 answer
  • Amylase increases the rate at which starch is broken down into glucose. What kind of molecule is amylase? . A) lipid . B)enzyme
    10·2 answers
  • Why is cytosis affected by oxygen levels
    7·1 answer
  • Why do organisms without oxygen need to convert pyruvate to lactate?
    15·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Why are proteins not usually used for energy?
    15·1 answer
  • Which of the following structural adaptations helps an organism obtain food?
    14·1 answer
  • Is a prion disease of deer and elk.
    9·1 answer
  • Which of the following is the best definition of Genetics?
    10·1 answer
  • What would be the most likely effect of a wildfire that burned a large area<br> of forest?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!