1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Y_Kistochka [10]
4 years ago
12

In animal cells, is/are usually a one way path​

Biology
1 answer:
scoray [572]4 years ago
5 0

In animal cells transcription is usually a one way path

You might be interested in
What do alcohol fermentation, acetyl CoA formation, and the Krebs cycle have in common?
amm1812
Hi!

The answer is B) all produce carbon dioxide.

Hope this helps!

-Payshence xoxo
6 0
3 years ago
In the Old field mice example scientists found variation in fur color ranging from light to dark brown. One might think they are
V125BC [204]

Answer:

Specie is a group of organisms that can interbreed with one another and produce fertile offspring.

Explanation:

Species Concept that applies to this situation is that a specie is a group of organisms that can interbreed with one another and produce fertile offspring. According to the example of mice, we can conclude that species having different appearance if belongs to the same group so it can interbreed with one another and produce offspring which is fertile and continue its generation.

7 0
3 years ago
A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
Finger [1]

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

6 0
3 years ago
In order to improve fat digestion, large fat globules must first be dispersed into smaller droplets in a process called ________
Ludmilka [50]

In order to improve fat digestion, large fat globules must first be dispersed into smaller droplets in a process called <u>emulsification.</u>

<h3 /><h3>What is emulsification in the digestive system?</h3>

Fat emulsification is the process of increasing the surface area of fats in the small intestine by grouping them into small clusters. Large lipid globules are split up into a number of smaller lipid globules. In the chyme, these tiny globules are widely dispersed rather than aggregating into larger groups. Hydrophobic compounds include lipids. Bile salts, are present in bile and have both hydrophilic and hydrophobic sides.

Due to the fact that lipases can only effectively act on lipids when they are broken down into small aggregates, emulsification is crucial for the digestion of lipids. The lipids are converted into fatty acids and glycerides by lipases.

Learn more about emulsification here:

brainly.com/question/14305593

#SPJ4

5 0
2 years ago
What process is responsible for creating magnetic changes along mid-ocean ridges?
Rama09 [41]

Answer:

The answer would be A. Reversal of Earths magnetic field

Explanation: This process is responsible because over time Earth's magnetic field changes, therefore it creates magnetic changes. It changes minerals in rocks and elements.

4 0
4 years ago
Other questions:
  • Compare and contrast saturated and unsaturated fats
    12·1 answer
  • Imagine a population of small animals. All of the animals in this population have short legs. They all eat the leaves off of the
    8·1 answer
  • What was the difference between the gametes produced without crossing over and the ones produced with crossing over
    5·1 answer
  • Which of the following is NOT a component of Sternberg's triangular theory of love?
    5·1 answer
  • How would a woman astronaut ejected from an airlock with out her spacesuit or helmet die?
    13·1 answer
  • 3. Were you able to restore the land? Why or why not?
    14·2 answers
  • suppose you are given two clay balls of equal size and shape. The two clay balls also wiegh the same. If one ball is flattend in
    8·1 answer
  • Compare the structures for genetics with every day objects. Must include the words: genes, DNA, chromosomes, and nucleus.
    7·1 answer
  • Which of the following is an example of a beneficial mutation?
    7·2 answers
  • Sedimentary Rock Questions. Will give brainliest
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!