Answer:
The sensitization and awareness campaign by Teddy's organization was aimed to prevent greenhouse effects by preserving the integrity of the ozone layer in deflecting the dangerous ultraviolet radiation from the sun.
Explanation:
Products such as aerosols, refrigerators, and other substances that can release Chlorofluorocarbons (CFCs) had been banned due to their bye product of CFCs which had been studied to be harmful to the ecosystem, especially the stratosphere.
The released CFCs are volatile and escape faster due to their low relative density. Therefore, they tend to get into the upper atmosphere within a couple of minutes. When CFCs and Ultraviolet radiation reacts, it leads to the formation of mono oxides of chlorine and bromine. These fragments (Cl2O and Br2O) are capable of reducing the protective ozone shield into ordinary oxygen, which cannot prevent the penetration of harmful ultraviolet radiation into the earth, which cause mutation of DNA and destruction of protein content of the animals and plants on the earth, and finally to cancer and other genetic mutation problems.
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
You never put the answer choices so I can’t answer this question