1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Readme [11.4K]
3 years ago
9

In the skeletal system, which are the two main tissues responsible for structural support in the body?

Biology
1 answer:
s344n2d4d5 [400]3 years ago
7 0
The two main tissues responsible for structural support are BONES AND CARTILAGES. Bone which is made up of collagen and calcium phosphate provides support and protection for body organs. Cartilage which is made up of closely packed collagenous fibers provides flexible support for some structures such as ear, nose and trachea. 
You might be interested in
Which of the following takes place in the light-dependent reactions of
Fantom [35]

Answer:

b) Energy is Captured.

The sunlight is converted to chemical energy

go for it!!

5 0
3 years ago
Which group of Eukarya has complicated the phylogenetics of the domain by first being thought of as ancient as compared to the m
Dmitriy789 [7]

Answer:

arches bacteria hope this helps

6 0
3 years ago
What distribution of phenotypes would be expected for a polygenic trait?
rewona [7]
 The number of phenotypes produced for a given trait depends on how many genes control the trait. Anyhow, The distribution of phenotypes for a typical polygenic trait can often be expressed as a bell-shaped curve.

Many traits are controlled by two or more genes and are, therefore, called polygenic traits<span>. Each gene of a polygenic trait often has two or more alleles. As a result, one polygenic trait can have many possible genotypes and phenotypes.</span>
4 0
3 years ago
Which terms is a process that is made up of two other term
faust18 [17]
It’s photosynthesis
6 0
3 years ago
The function of centrosome in plant cell is performed by
Andrews [41]
<span>Centrosomes are made of from arrangement of two barrel-shaped clusters of microtubules, called “centrioles,” and a complex of proteins that help additional microtubules to form.</span>
4 0
4 years ago
Other questions:
  • 18) __________ are found in BOTH viruses AND in living single-celled organisms, such as protozoans and bacteria.
    8·1 answer
  • Please discuss why it is important to represent your scientific data in the best format.
    6·1 answer
  • Just a few hours after the birth of a baby, the mammary glands start producing milk. Which hormone stimulates this event?
    14·2 answers
  • If you looked at unknown cells under a microscope, what could lead you to correctly conclude that they are bacteria cells?
    13·1 answer
  • Which two statements describe the advantages of genetic engineering
    9·1 answer
  • There are more species of _____ than of any other type<br> ofanima.
    11·1 answer
  • A scientist wants to test how much of an acid can be added to a solution
    13·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Can you please help me!!!
    11·1 answer
  • Which statement is true of the many parts if the biosphere
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!