1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ANEK [815]
3 years ago
10

Somebody help me plsss

Biology
1 answer:
klio [65]3 years ago
7 0

Answer:

1. give up 1

2. give up 2

3. give up 3

4. gain 3

5. gain 2

6. gain 1

Mark me as brainliest if you found it helpful

You might be interested in
How do earths major ecosystems differ
lakkis [162]
What is this for is it biology
8 0
3 years ago
Read 2 more answers
Which of the following is an alternative energy
Dima020 [189]

Alternative energy sources are those that do not deplete natural resources and do not harm the environment.

Options A, B, and C are all fossil fuels, which we know can be depleted and harm the environment.

The only valid option here is D, Geothermal energy.

Geothermal energy is both renewable and environmentally friendly.

5 0
3 years ago
Read 2 more answers
4. Which of the following is true about a mutation? A.) it is always damaging to a person B.) it never harms the next generation
DaniilM [7]

Answer:

D

Explanation:

Mutation can be harmful and it can have no effect.

4 0
2 years ago
Read 2 more answers
Which are older the atoms in the body of an elderly person or those in the body of a baby?
sergeinik [125]
Search on google or google asl or yahoo ask
5 0
3 years ago
Organisms may contain up to five levels of organization within their bodies. Which level of organization is shown by the liver?
Vika [28.1K]

The liver is at a #3 level of organization, an organ..which has a specific job to do in the body.

5 0
3 years ago
Read 2 more answers
Other questions:
  • 9. If you could choose one ecosystem to spend the afternoon, would you choose the beach, the mountains, grasslands, or desert? W
    7·2 answers
  • 1) In 1783 Antoine Lavoisier showed that the heat produced by respiration was comparable to the heat produced when charcoal was
    5·2 answers
  • Which of these is a solution?a. oil and waterb. soda popc. h2o
    14·1 answer
  • The type of environment where a population of organisms lives is know as
    6·1 answer
  • Identify a sport that you are familiar with. Identify a skill in that sport that you are familiar with. (ex. Basketball: shootin
    13·1 answer
  • One tactic to help bee populations stay healthy is raising hygienic bees. Hygienic bees contribute to overall disease resistance
    5·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What powers the movement of material in the mantle
    10·1 answer
  • Define nutrition in your own words ?<br>Thank you​
    14·1 answer
  • Who designed the labyrinth of king minos in greek mythology?.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!