1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lubasha [3.4K]
3 years ago
5

The three agents of metamorphism are _____. melting, pressure, and weathering heat, pressure, and hydrothermal solutions heat, e

xtrusion, and running water
Biology
2 answers:
oksian1 [2.3K]3 years ago
6 0
<span> The </span>agents of metamorphism<span> include heat, pressure (stress), and chemically active fluids.</span>
Ede4ka [16]3 years ago
6 0

The three agents of metamorphism are heat, pressure, and hydrothermal solutions! It's in my textbook, and I got it right on the quiz I just took.

You might be interested in
6. Applying Ideas: Suppose someone dumped left over motor oil on a driveway. Could this disposal
Rufina [12.5K]

Answer:

If they are looking for one BEST answer, it is the water.

If looking for top two, it is water and soil.

Realistically, however, this disposal can contaminate all 3.

Let me explain:

The motor oil that is dumped on a driveway first makes its way into the soil. The freshwater found in this soil becomes contaminated with motor oil and can eventually runoff into the ocean. Once this liquid evaporates, it then becomes air pollution. Shortest, best answer tho is water.

Hope this helps. Have a great day!

6 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
) consider the trait of courage. describe the advantages and limitations of obtaining informant report data for this trait.
mariarad [96]
The advantages and limitations of obtaining informant report data for the courage trait are;
Advantages include; 
Large amount of information
Definitional truth based on the observed acts of courage.
Limitations on the other hand include; 
Very little behavioral data,
Error; much more likely to remember acts of courage than non-courageous acts.

8 0
3 years ago
How has evolution affected animal intelligence?
horrorfan [7]

Answer: they develop human like intelligence as time goes on

Explanation:

7 0
3 years ago
Which of the following is not common to both prokaryotic and eukaryotic cell division?
julsineya [31]

The correct answer is: A checkpoint will be activated if the spindle does not attach to a kinetochore.

Prokaryotes, do not undergo mitosis (like eukaryotes) and therefore have no need for a mitotic spindle. Prokaryotes also don’ t have checkpoints foor the regulation of cell division.

Normal eukaryotic cells (unlike cancer cells), move through the cell cycle in a regulated way in order to make sure that cells don't divide under conditions that are unfavorable for them. Information about their own internal state (nutrients, signal molecules, DNA integrity) is signal to go or not to go through the cell division. Because of that there are few checkpoints in the cell cycle at which the cell examines the signals and makes a “decision”. The major checkpoints are:

• The G1- the first point at which it must choose, once it passes the G1 checkpoint the cell enters S phase

• The G2-the cell checks DNA integrity and checks if replication is done well.

• The spindle checkpoint-at the transition from metaphase to anaphase.

3 0
3 years ago
Read 2 more answers
Other questions:
  • What happens to the brain when addicted to drugs
    9·2 answers
  • The enzyme responsible for converting androgens to estrogens is select one:
    9·1 answer
  • A chemical that is contained at the end of the axon whose purpose is to pass information on to another neuron is called a(n):
    9·1 answer
  • The nurse is caring for a very anxious child whose pain has not been manageable. the parents stay in the child's room, crying an
    11·1 answer
  • After buying a new house by the lake, the Harrison's decided to cut down the trees and bushes that were blocking
    13·1 answer
  • What is energy? what is an example of it ?
    11·2 answers
  • Which of the following would most likely happen if the epithelial cells in the stomach failed to produce mucus?
    7·2 answers
  • a grown tiger begin its life as a single fertilized egg explain why a tiger look so much different as an adult then it did as a
    15·1 answer
  • Thinking about the structure and function of leaves, work with your group to propose modifications you might to expect to see in
    6·1 answer
  • How are photosynthesis and cellular respiration related?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!