1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dimas [21]
3 years ago
7

A neutron star collapses into a black hole because of the force of (fusion,gravity)

Biology
1 answer:
stealth61 [152]3 years ago
7 0
Gravity

Neutron stars are the most extreme and fascinating objects known to exist in our universe: Such a star has a mass that is up to twice that of the sun but a radius of only a dozen kilometers: hence it has an enormous density, thousands of billions of times that of the densest element on Earth. An important property of neutron stars, distinguishing them from normal stars, is that their mass cannot grow without bound. Indeed, if a nonrotating star increases its mass, also its density will increase. Normally this will lead to a new equilibrium and the star can live stably in this state for thousands of years. This process, however, cannot repeat indefinitely and the accreting star will reach a mass above which no physical pressure will prevent it from collapsing to a black hole. The critical mass when this happens is called the "maximum mass" and represents an upper limit to the mass that a nonrotating neutron star can be.

However, once the maximum mass is reached, the star also has an alternative to the collapse: it can rotate. A rotating star, in fact, can support a mass larger than if it was nonrotating, simply because the additional centrifugal force can help balance the gravitational force. Also in this case, however, the star cannot be arbitrarily massive because an increase in mass must be accompanied by an increase in the rotation and there is a limit to how fast a star can rotate before breaking apart. Hence, for any neutron star, there is an absolute maximum mass and is given by the largest mass of the fastest-spinning model.
You might be interested in
List at LEAST two other examples of environmental conditions that could determine which traits are adaptive.
SVEN [57.7K]

Answer:

heat

rainfall

Explanation:

heat and rainfall determine which traits are adaptive

7 0
2 years ago
What is the skeleton of an embryo mainly composed of?
tatyana61 [14]
Cartilage would be your answer.
3 0
2 years ago
Read 2 more answers
how is the expression of sex linked genes both  similar to and different from the expression of autosomal genes?
svet-max [94.6K]
Sex chromosomes contain genes that determine the sex of a person. Two X chromosomes result in a female and one X plus a Y result in a male.

In those chromosomes, there are genes specific for each gender, and in those chromosomes, there are genes that code for certain traits- the sex-linked traits.
These traits will be inherited according to the sex chromosomes they receive from their parents. Women recieve one X from the mother and the other from the father while  men recievethe X from the mother and the Y from the father).

This will cause a <u>difference</u> in the expression of genes because women can become carriers of a certain disease while men either manifest it or don't (there are no carriers since the X chromossome is different than the Y)

In autosomal genes, the expression doesn't depend on the gender since the autosomal chromosomes contain genes that code for the same trait, and so the expression on autosomal genes in men and women are <u>similar</u><u>.</u>


8 0
2 years ago
Read 2 more answers
On microscopic examination, John observed yeast cells dividing into daughter cells. What type of asexual reproduction does this
Katen [24]
Binary fission; It occurs when a  prokaryote or a single celled eukaryote reproduces asexually and divides into two similar sized daughter cells rather than a bud or fragments, which is found in budding and fragmentation. <span />
5 0
3 years ago
"Which colors of the light spectrum are most important for plant growth?"
k0ka [10]

Answer:

green colour is most important

3 0
3 years ago
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The dark brown organic material found in soil is called __________. Question 13 options: compost fertilizer humus sediment
    12·1 answer
  • In which compartment would fluid accumulate in edema?
    8·1 answer
  • When a living organism dies, it stops taking in new carbon. Thus, as the radioactive carbon-14 decays, the ratio of carbon-12 to
    14·1 answer
  • What is the term for a female reproductive cell?
    15·1 answer
  • The mass of an atom is contained primarily in its _____. electron shell nucleus protons size
    9·2 answers
  • Population crashes cannot happen to humans?True False?<br><br>​
    9·1 answer
  • A researcher claims that a newly discovered microorganism is an autotroph. Which observation would support his claim?
    13·1 answer
  • The producers had 6,000 kcal of energy , how much would be passed to the primary consumer?
    8·1 answer
  • What is the name of the disease caused by a lack of thyroid hormones?​
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!