1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Flura [38]
3 years ago
13

The least specific level of classification is: A.Phylum B.Domain C.Order D.Genus

Biology
2 answers:
galben [10]3 years ago
5 0

Answer:

species

Explanation:

use this acronym king pharaoh can order for general scientists. king for kingdom, pharaoh for phylum,can for class,order for order, general for genus and scientists for species

Tamiku [17]3 years ago
3 0

Answer: the answer is c

Explanation: C. Provide a root to the phylogenetic tree by choosing a noncontroversial out group. D. ... B. domain, kingdom, class, phylum, order, family, genus, species. C. i hope this helps i learnd this way in class

You might be interested in
Although efforts were made to protect the Western Black Rhinoceros, it is thought that man has directly caused its extinction by
otez555 [7]

The answer is B hunting ans poaching the animal for its horn

7 0
3 years ago
Read 2 more answers
In the fungal life cycle, karyogamy results in:______.
Vikentia [17]

Answer:

In the fungal life cycle, karyogamy results in D. fungi haploid nuclei from two parent fungi fuse together

Explanation:

Karyogamy has an important role in sexual reproduction. It is the last step in the process of fusing together two haploid eukaryotic cells, and refers specifically to the fusion of the two nuclei. This is the steps that usually follows the Plasmogamy stage. This step is part of the sexual reproduction of fungi too. Karyogamy is key because it helps recombine two different genetic material.

7 0
3 years ago
The subunit (organelle) of the sperm that supplies the energy for motion is _____.
Andreyy89
The answer is the mitochondria
8 0
3 years ago
Read 2 more answers
One hypothesis of viruses states that small viruses started as
nexus9112 [7]

Answer:

Origin of Viruses. ... Small viruses started as runaway pieces of nucleic acid that originally came from living cells such as bacteria. Large viruses were once parasitic cells inside bigger host cells. Over time, genes needed to survive and reproduce outside host cells were lost.

8 0
3 years ago
The largest and most complex mitochondrial genomes come from _____.
alexandr1967 [171]

Answer:

Angiosperm

Explanation:

The mitochondria of flowering Angiosperm plant are the largest. The size of these mitochondria varies from 1.86 million bp to 2.4 million bp. It is also the most complex one as it carries large number of repeating units which allows multiple permutations for recombination. This allows generation of mitochondria of varying sizes with in the same species.

It is least gene dense  as the inter regions are highly expanded. One of the most distinguishing feature of these mitochondria's are that they contain polypeptides. These polypeptides are basically non functional but have potential to evolve into functional one.

8 0
4 years ago
Read 2 more answers
Other questions:
  • Considerando a forte radiação solar e o clima quente da África onde nossos antepassados evoluíram, que importância tiveram as gl
    14·1 answer
  • The anemia resulting from a deficiency of either vitamin B 12 (cobalamin) or folate is caused by a disruption in DNA synthesis o
    9·2 answers
  • What does lifestyle have to do about overweight/obesity?
    7·2 answers
  • What temperature resulted in the most active yeast?<br> A)<br> 4°C<br> 15°C<br> 22°C<br> 36°C
    7·2 answers
  • You have a nutrient broth, an agar slant, and an agar plate with bacterial growth in or on each. If you wanted to evaluate the m
    13·1 answer
  • Mengapakah biodiversiti wujud
    13·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • What are some effects of the tiny beads called microplastics that are a large component of ocean garbage patches?
    10·1 answer
  • (01.03 LC) A student is trying to calculate the density of a can. He already knows the mass, but he needs determine the volume a
    6·1 answer
  • Hellppppp please will give brainliest ​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!