1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klemol [59]
3 years ago
7

This graph represents the probability of a particular type of severe weather occurring in two cities

Biology
1 answer:
ahrayia [7]3 years ago
4 0

Answer:

The correct answer for this question is B. Tornadoes. 

Explanation:

Based on the information of the graph and including the things you have learned about severe weather in this unit, the severe weather that is represented by the lines on the graph are tornadoes.

You might be interested in
Earth's biosphere is described as
xxTIMURxx [149]

Answer:

the layer of the planet Earth where life exists

Explanation:

5 0
3 years ago
Read 2 more answers
How can scientists communicate their findings
S_A_V [24]
Scientist can communicate their findings by putting them on a journal and publish them 
6 0
3 years ago
Read 2 more answers
If u do this omg ur a life savior
KiRa [710]

Answer: Aight Uhh Ok.

Explanation:

3 0
3 years ago
Read 2 more answers
Which part helps to keep the shape of a cell?
Darya [45]

Answer:

the nucleus

Explanation:

it is an his function

6 0
3 years ago
Read 2 more answers
Are sea water, rocks, sand and silt abiotic or biotic?.
mart [117]

Answer:

they are abiotic

Explanation:

4 0
1 year ago
Other questions:
  • PLEASE HELP!
    8·1 answer
  • Which of these is a compound?
    12·1 answer
  • Which of the following statements is true?
    8·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which occurs during translation
    14·1 answer
  • Cellular differentiation and morphogenesis in plants depends primarily on _____.
    8·1 answer
  • One main difference between dementia and delirium is that delirium only affects people over the age of 65. Please select the bes
    5·2 answers
  • How will costs compare during and after construction of wind turbines?<br> PLEASE ANSWER!!!
    14·1 answer
  • Do you think chickens and other birds can be descendants of other dinosaurs?
    13·1 answer
  • In what direction, clockwise or counterclockwise, do the major circulation patterns rotate in the northern and southern hemisphe
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!