1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MariettaO [177]
3 years ago
15

In the kidneys both useful and wasteful substances are removed from the blood by A. reabsorption. B. excretion. C. filtration. D

. respiration.
Biology
1 answer:
SVEN [57.7K]3 years ago
4 0
 the answer is :
C)filtration
You might be interested in
Considering the Mendelian traits tall (D) versus dwarf (d) and violet (W) versus white (w), consider the crosses below and deter
Artyom0805 [142]

Answer:

DDWw x Ddww

DdWw x DDww

DDWw x DDww

Explanation:

D for tallness

d for dwarfness

W for violet

w for  white

For Parental Plants that has

tall, violet x tall, white

 The representation will be

DDWW × DDww      (We the apply the mendelian crossing)

This will yield offsprings with the following trait

DDDD × DwDw

DDDD × DwDw

DWDW x WwWw

DdWw x ddww

Ddww x ddWw

DdWw x DdWw

DDWw x ddww

From the above Offsprings

1/2 tall, white and 1/2 tall, violets offspring are

DDWw x Ddww

DdWw x DDww

DDWw x DDww

7 0
3 years ago
Which statement accurately compares archaebacteria and eubacteria?
Readme [11.4K]

Answer:

maybe

Explanation: both idk for sure sry i tried

3 0
3 years ago
Introduction of an invasive species to an ecosystem can have some harmful effects including predation of existing species, compe
gregori [183]

B is the most effective and feasible, and it prevents the initial introdution of the species

3 0
3 years ago
What is the definition of the length constant? What does the length constant tell you in terms of the electrical signal? Neurons
Furkat [3]

Answer:

The overview of the given problem is outlined in the following section mostly on explanation.

Explanation:

The constant length seems to be a constant value which used to measure the distance between the grade electron density and the neurite through passive electron flow.  The larger the quality of the distance constant, the faster the potential goes, throughout consideration of the electronic current.

  • The electronic replacement through one potential from neighboring areas including its cell will lead with the spatial description by a broad constant of length.  
  • This length decreases with either the size of that same neuron rising.
  • The length constant, means of characterizing how much continuous current that flows extends until it bursts out from the axon, despite constants of limited period meaning leakier axons.  
  • The resistance of that same membranes should be just as efficient as possible as well as the tolerance of its axoplasm or extracellular media must be weak to enhance the efficient movement of current via an axon.
6 0
3 years ago
what are the morphological chemical function and similarities different between lysosomes and peroxisome​
bearhunter [10]

Answer/explanation:

Differences: lysosomes have digestive enzymes (hydrolases) that break substances to be digested into small molecules; peroxisomes contain enzymes that degrade mainly long-chained fatty acids and amino acids and that inactivate toxic agents including ethanol; within peroxisomes there is the enzyme catalase, responsibal

5 0
3 years ago
Other questions:
  • Turning off these genes ca cause less mature cells to divide too rapidly.What could this lead to the development of
    7·1 answer
  • What are the responsibilities of the region of the brain highlighted below?
    11·2 answers
  • How do humans obtain the nitrogen they use in their bodies
    5·2 answers
  • Roles in aquaculture​
    9·1 answer
  • alguien que me ayude con esta pregunta por favor cuáles son las enfermedades que se desarrollan lentamente pudiendo durar mucho
    5·1 answer
  • The specific tRNA molecule (with a specific amino acid attached) attaches in the correct place because it has four bases at the
    9·1 answer
  • Which of the following lists the correct symbol for the ion that tin forms when it loses 2 electrons, the correct classification
    15·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • I NEED HELP WITH THIS QUESTION ASAP PLEASE AND THANK YOU!
    10·2 answers
  • describe the role of deep fascia in compartmentalizing the segments of the limbs (i.e., arm, forearm, thigh, leg).
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!