1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paladinen [302]
3 years ago
7

PLEASE HELP!!!!!!1 REALLY IMPRTANT!!! The foodservice department started the year with 20 employees; three have left employment.

What is the turnover rate? a. 6.6% b. 12% c. 15% d. 85%
Biology
1 answer:
Alex_Xolod [135]3 years ago
8 0
Fifteen percent darlin
You might be interested in
A true-breeding plant that produces yellow seeds is crossed with a true-breeding plant that produces green seeds. The F1 plants
nadya68 [22]

Answer:

The phenotypic ratio will be 3:1

Explanation:

As per this question there are two phenotypes for seed color, yellow and green. Both the parents are true breeding that means they are homozygous for this trait. Also, all the F1 plants have yellow seed color which clearly indicates that yellow seed color is a dominant trait while green is recessive trait.

The cross of true breeding plants as mentioned above is depicted as under:

Parents                             YY    x   yy

                                          /   \       /   \

F1 generation                Yy   Yy  Yy   Yy

So, as per the law of dominance because of the presence of Y allele, all these progeny will be yellow in color.

Next, when these F1 plants will be crossed, the result will be as under:

F1 generation                    Yy   x    Yy

                                         /   \         /   \

F2 generation               YY   Yy   Yy   yy

The genotypic ratio of F2 generation is 1:2:1

The phenotypic ratio of F2 generation is 3:1

It simply means that in F2 generation, 3 progeny which have allelic combination YY & Yy will be yellow colored while 1 progeny which has allelic combination yy will have green color.

8 0
3 years ago
The study of body structure is called
alexandr1967 [171]
The study of body structure is called Anatomy
8 0
3 years ago
A photosystem is:
miss Akunina [59]
C, a collection of photosynthetic protons arranged in a thylakoid membrane. 
4 0
3 years ago
What are marine sponges compossed of
OleMash [197]
Sponges are similar to other animals in that they are multicellular, heterotrophic, lack cell walls and produce sperm cells. Unlike other animals, they lack true tissues and organs, and have no body symmetry. The shapes of their bodies are adapted for maximal efficiency of water flow through the central cavity, where it deposits nutrients, and leaves through a hole called the osculum. Many sponges have internal skeletons of spongin and/or spicules of calcium carbonate or silicon dioxide. All sponges are sessile aquatic animals. Although there are freshwater species, the great majority are marine (salt water) species, ranging from tidal zones to depths exceeding 8,800 m (5.5 mi).
3 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • Predict biodiversity changes that would be expected to occur in response to changing environmental factors
    13·1 answer
  • What is the difference between seaweed, kelp, and algea
    10·1 answer
  • What happens in each of the three main stages or processes of memory
    10·2 answers
  • Species extinctions can cause which of the following?
    12·1 answer
  • Eplain I terms of osmosis why a raisin placed in a cup of water overnight will puff up with water
    5·1 answer
  • A(n) ________ neuron has one axon and one dendrite extending directly from the cell body.
    9·1 answer
  • Ultrasound technology is used to create medical images. <br><br> True or False?
    10·2 answers
  • Base your answer to the following question on the chart below
    13·2 answers
  • Following are assertion and reasoning questions. Read the two statements labelled as A and R. Pick any of the
    10·1 answer
  • Choose two that are true about fungi. *
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!