1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sidana [21]
3 years ago
14

Predators often control the population of their prey. If wolves are removed from a specific community, the population of moose i

ncreases and another predator may take the place of the wolf.
Biology
2 answers:
scoundrel [369]3 years ago
8 0

Answer:

Keystone species

Explanation:

i just did it on usa testprep

Salsk061 [2.6K]3 years ago
5 0
Im not sure what the question is but the population of moose would increase but It could also stay the same if there was another predator plus the population of moose could also decrease if that other predator hunted them alot
You might be interested in
What’s the difference between an objects mass and weight. How do I calculate the weight of an object? Which one is affected by g
vagabundo [1.1K]

Answer:

The mass of an object is a measure of the amount of matter it contains. The weight of an object is a measure of the force exerted on the object by gravity, or the force needed to support it. Mass does not change with gravity as weight does due to the act of pulling down on an object making it in fact heavier.

Explanation:

^

4 0
3 years ago
Choose the best definition for the term PHENOTYPE.
anyanavicka [17]
"The set of observable characteristics of an individual..." is what i found on google, so i'm guessing its a.

                  hope this helps :)
8 0
3 years ago
Read 2 more answers
Why are cells limited in size?
seropon [69]
Cell is limited in size for many reasons. Cells wouldn't be respire effectively if it were too large, because the surface area to the volume ratio would be too small.
The other thing is that if the cell were too large, it would be difficult for it to move nutrients and waste products in and out of the cell. So, cells are limited in size.
5 0
3 years ago
SOMEONE PLEASE HELP ME
saveliy_v [14]

Explanation:

through the process of cellular respiration energy in food is coverted into energy that can be used in body's cells, glucose and oxygen are converted into carbon dioxide and water and the energy is transferred to ATP- the energy carrying molecule that provides energy for your cells to work, such as moving muscles

4 0
3 years ago
A cyclist rode at an average speed of 15 mph for 30 miles. How long was the ride?
fomenos

Answer:

A. 2 hrs

Hope This Helps!

3 0
3 years ago
Read 2 more answers
Other questions:
  • Each human egg has 46 chromosomes and the sperm has no chromosomes.<br> a. True<br> b. False
    10·2 answers
  • Gizmo Lab Activity: Chicken Genetics Answer Sheet cant find it anywhere!?
    12·1 answer
  • The proteins in the cell membrane allow substances to come or go, based on their concentrations. This is an important part of __
    10·2 answers
  • 6) Where is the star? Write the latitude and longitude
    10·1 answer
  • Homeostasis and adaptation are both forms of _____.
    7·1 answer
  • Jack is studying a few new leaf samples. The first leaf sample has a single leaf blade. The second had leaflets arising from a s
    9·1 answer
  • What is the volume of a cylinder if the height is 6 cm and the radius is 4 cm?​
    15·1 answer
  • A dinoflagellate is a microscopic organism that is very common in the ocean. It consists of a single cell and has a flagella tha
    13·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Completar:<br><br>En la de un cuerpo sólido no influye su .​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!