1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kotykmax [81]
3 years ago
12

How do the number of electrons in the second energy shell of an atom change going across period 2 in the periodic table?

Biology
1 answer:
Viktor [21]3 years ago
7 0
C. But be aware it increases in the third shell by 1 from left to right
You might be interested in
Corals feed on eachother true or false
Anna007 [38]
False. <span>Adult corals are sessile organisms, i.e. they don't move around. They are tiny organisms whose shells are what we generally see.</span>
8 0
3 years ago
Read 2 more answers
What would happen to a plant cell in a hypotonic solution
mash [69]
<h2>Answer:</h2>

<u>When a plant cell is placed in a hypo-tonic solution It becomes turgid and hard.</u>


<h2>Explanation:</h2>

A hypotonic solution refers to a solution that has less solute and more water than another solution. When the plant cell is placed in a hypotonic solution, it takes up water by osmosis and starts to swell, but the cell wall prevents it from bursting. The plant cell is said to have become "turgid" i.e. swollen and hard. The pressure inside the cell rises until this internal pressure is equal to the pressure outside.

4 0
3 years ago
HELP PLEASE!!!!!!!!
wlad13 [49]
Same number of atoms on the outer shell, will have similar melting and boiling properties
6 0
2 years ago
What are two Earth irregularities that can change the intensity of the seasons?
artcher [175]

Answer:the orbit around the sun and the planets tilted axis

Explanation:

4 0
3 years ago
What renal and hormonal factors will cause an increased release of aldosterone from adrenal cortex?
bagirrra123 [75]

Answer:

Renin; angiotensin I and angiotensin II

Explanation:

Renin is a key hormone involved in the renin-angiotensin-aldosterone system (RAAS), which is responsible for regulating blood pressure in response to changes in blood volume. Renin is secreted primarily by the kidneys to promote the production of the peptide hormone angiotensin in the blood vessels. Subsequently, angiotensin stimulates the release of aldosterone from the adrenal cortex, stimulating sodium retention by the kidneys. Renin acts on its substrate angiotensinogen to yield angiotensin I, which is then converted to angiotensin II by the angiotensin-converting enzyme (ACE). Finally, angiotensin 2 promotes the release of aldosterone by the adrenal cortex, which acts on renal tubules, leading to the reabsorption of sodium and water and the excretion of potassium.

7 0
3 years ago
Other questions:
  • The nurse caring for the pregnant client must understand that the hormone essential for maintaining pregnancy is:
    15·1 answer
  • What is the domain of bacteria
    5·1 answer
  • Are coral snakes venomous?
    10·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What is a phospholipid, and what is a second messenger?
    11·1 answer
  • Scientists compare two different plant species. In species A, the leaf color is controlled by two alleles. In species B, leaf co
    12·2 answers
  • After surviving a bottleneck, a population recovers to the point where it consists of as many individuals as it did prior to the
    13·2 answers
  • Simon wrote the following statements to describe how the oceans were created.
    5·2 answers
  • What are the outputs of the Digestive System?
    11·2 answers
  • The action force in the cell is:
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!