1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olya-2409 [2.1K]
3 years ago
7

Please help THANK YOU need help ASAP :)))) !!

Biology
2 answers:
Cerrena [4.2K]3 years ago
8 0
Question one is c and question two is a
olga55 [171]3 years ago
3 0
Question one is C and I know that for a fact hun!
You might be interested in
When the moon apprears to be growing larger it is said to be?
tresset_1 [31]
I think its illuminating
4 0
3 years ago
Do Different cell types also have special duties, like building skin or bone, pumping out hormones, or making anti-bodies.
Schach [20]

Answer:

Yes, different cell types also have special duties, like building skin or bone, pumping out hormones, or making anti-bodies.

Explanation:

Cell is the basis structural and functional unit of a living organism. The body of a human is composed of trillions of cells that are organized in around 200 types of cells.

<u>A tissue is simply a group of specific kind of cell that have  a specific role.</u>

  • For example: The nervous system contains cells called neurons that have ability to transmit message from one place to another and allow us to respond to any environmental stimuli, such as heat, cold, danger etc.
  • Skin cell is composed of cells that have a role in protecting the body against the attack of harmful microbes. They also protect have role in building new skin cells and adding the protection to our body.
  • Blood cells have a role in providing us immunity (for example white blood cells) therefore, make us better able to protect ourselves from danger of diseases.
  • Muscle cells help us in moving our organs as well as allowing the whole movement from one place to another.

Thus we see that different types of cells have special functions and all these different cells coordinate with each other to make an organized and functioning body of a living organism.


Hope it help!

7 0
3 years ago
Which type of macromolecule is made of amino acids?
Rudik [331]
Protein. im absolutely certain
4 0
3 years ago
Read 2 more answers
Which best describes how to classify water?
Anastaziya [24]

Answer:

b)It is a compound because it is made of a single kind of molecule.

Explanation:

8 0
3 years ago
Read 2 more answers
Which is the independent variable in this graph?
Leto [7]
Years would be the independent variable because any sort of time is usually the independent variable.
4 0
3 years ago
Other questions:
  • The map above shows some of Earth's plate tectonic boundaries.
    15·1 answer
  • The roots of plants are important to photosynthesis because they...
    10·2 answers
  • Predator-prey relationships are shown through
    11·2 answers
  • What distinguishes disruptive and directional selection pressures when both select for extreme genetic traits?
    11·2 answers
  • What is a pterophytes.
    13·2 answers
  • 19. List the 4 major organic compound groups and briefly describe each group
    6·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is a hypothesis?????​
    10·2 answers
  • Cladistic diagrams, or cladograms, can be used to show evolutionary relationships. An example of a cladistic diagram appears bel
    13·2 answers
  • What type of cell is shown below?<br> Plant cell,egg cell,eukaryotic cell,prokaryotic cells?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!