1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LenKa [72]
3 years ago
8

What happens when a limb no longer receives blood?

Biology
1 answer:
oee [108]3 years ago
8 0
The surrounding tissue cannot receive oxygen and they begin to die.
You might be interested in
I) Predict which of the liquids would cause the largest decrease in mass of a potato stick
rjkz [21]

Answer:

1.0 mole per dm3 sodium chloride solution

Explanation:

<em>The more the molarity of a solution, the lower the water potential of the solution, and the higher the amount of water that will osmotically move from the potato stick to the solution when placed in it in order for an equilibrium to be established. </em>

Hence,<u> the 1.0 mole per dm3 sodium chloride solution will cause the largest decrease in the mass of the potato stick</u> when compared to the 0.5 and 0.1 mole per dm3 sodium chloride solutions.

7 0
3 years ago
Forms of Energy
shusha [124]

Answer:

don't know this one sorry

6 0
2 years ago
The point where the musle attaches to the bone to be pulled is called the... A Insertion B Sarcomere
irina [24]
I agree it is insertion 

8 0
3 years ago
PLEASE HELP
Airida [17]

Answer:

well you mixed two different types or colors of flowers

Explanation:

8 0
3 years ago
Scientists estimate that only 1 percent of prokaryotes can be grown in the lab. what does this suggest about our knowledge of ba
uysha [10]
This suggests that the knowledge we know about these species is very limited. Through deeper research and gaining of samples of these bacteria, scientists will be able to determine how to culture these prokaryotes better, but this would still take a long period of time.
7 0
3 years ago
Other questions:
  • Which of the following molecules is made up of a glycerol molecule combined with fatty acids
    12·2 answers
  • What are PCB’s and where in the body do Tomcods store PCB chemicals?
    7·1 answer
  • Which type of jelly fish has the ability to reverse age its self when it becomes a certain age ?​
    13·2 answers
  • Where are the niagara falls located?
    10·2 answers
  • When martine listens to the sound of her cellphone ringing, several steps take place. when pressure waves in the cochlea move to
    9·1 answer
  • PLEASE HELP ME<br> BIOLOGY LOVERS
    13·1 answer
  • Determine which of the following statements is true about energy in ecosystems. A. Producers are able to convert 40% of the sun’
    8·1 answer
  • You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATT
    15·1 answer
  • Evaluate the use of embryonic stem cells and stem cells from adult bone marrow in the treatment of human diseases.
    12·1 answer
  • Plants breathe CO2 and release O2, while animals generally breathe O2 and release CO2. This is an example of an interaction betw
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!