1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldfiish [28.3K]
4 years ago
10

Mr. Morales is teaching a lesson on classification. He says that spiders are classified as a different group than insects becaus

e they have eight legs instead of six legs. He explains that spiders evolved first , mr. Morales also says that having eight legs is the derived trait that seperates the two groups. Antonio thinks Mr. Morales is wrong. Which piece of information is Antonio considering ?
Biology
1 answer:
Vedmedyk [2.9K]4 years ago
5 0

Hello! Your answer is


<em>Quote:</em>

<em>The correct answer is If spiders evolved first, six legs is the derived trait. </em>


<em>The teacher says that the insects have six legs and the spiders have 8 legs, but the spiders derived this trait and evolved prior than the insects. </em>


<em>The student thinks that the teacher is wrong because he thinks, of the spiders evolved first, the  the insects must have derived the 6 leg trait later in the evolutionary history. hence, the 6 leg trait should be derived trait, not the 8 leg trait. </em>



You might be interested in
Which of these is found within all cells?<br> Organ systems<br> Organs<br> Tissues<br> Molecules
GREYUIT [131]

Answer:

tissues

Explanation:

cells make tissues and tissues make organs

8 0
3 years ago
Lipids are unique in their structure and function. Which of the following is a characteristic of a type of lipid?
V125BC [204]

Answer:

<u><em>C</em></u>

Explanation:

Generally hydrophobic/ amphipatic. Water-insoluble organic compounds. Do not form large covalent polymers.

6 0
3 years ago
Read 2 more answers
Buffers are substances that resist shifts in pH by
kondor19780726 [428]
D and E the H+ ones
5 0
3 years ago
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
nydimaria [60]

I don see the question if there is one can you explain and ill edit my answer to best fit

8 0
3 years ago
DNA polymerase is an enzyme in eukaryotic cells whose function, in part, is to catalyze phosphodiester bonds formation between a
kap26 [50]

Answer:

Addition of nucleotides to form a complementary strand of DNA.

Explanation:

Replication of the genetic material (DNA) is a paramount process that must be undergone by any cell prior to its division. The series of processes that occurs to the DNA molecule during DNA replication is catalyzed by different enzymes with specific functions. However, one of these enzyme callee DNA POLYMERASE catalyzes the main event, which is the synthesis of a complementary strand.

DNA polymerase catalyzes the production of phosphodiester bonds that joins the nucleotides. The enzyme synthesizes a nuceleotide base complementary to the one on the template strand, to eventually form a new DNA strand. Hence, blocking the function of this enzyme is tantamount to blocking the synthesis of a new strand itself.

6 0
3 years ago
Other questions:
  • Through which conversion is energy released?
    12·1 answer
  • Give at least three facts autotrophs and heterotrophs on earth are true?
    15·1 answer
  • HELP QUICK! <br><br> A. 1,4,3,2 <br> B. 2,1,3,4<br> C.3,1,2,4 <br> D. 1,2,4,3
    9·1 answer
  • Which statements correctly describe mutations in gametes and mutations in somatic cells?
    7·2 answers
  • True or false Fats are usually of animal origin while oils are usually of plant origin
    12·1 answer
  • The many changes in the fossils of mammals that are recovered are BEST explained as a result of
    12·1 answer
  • PlS HELP 30 POINTS FOR BRAINLIEST!!!!!!!!!!!!!!!!!!​
    12·1 answer
  • Will Give BRAINLIEST 100pts
    6·1 answer
  • When mRNA is made from DNA it is called
    9·2 answers
  • Water molecules are _____ due to _____ bonding
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!