1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vinil7 [7]
3 years ago
5

What is the primary reason that species are overharvested?

Biology
1 answer:
son4ous [18]3 years ago
7 0
<span>Market demand for goods associated with a species.</span>
You might be interested in
Energy is released from ATP when
ycow [4]

Answer: The correct answer for the blank is-

Energy is released from ATP ( adenosine triphosphate) when high energy phosphoanhydride bond ( present between two phosphate) is broken down or hydrolyzed.

This results in the formation of ADP ( adenosine diphosphate) and Pi ( inorganic phosphate).

Therefore, hydrolysis of ATP releases energy.

3 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
The carbon footprint of an activity is used to assess environmental pollution. What does it measure?
ohaa [14]
The one that Carbon footprint measures is : Greenhouse Gasses

Carbon Footprints are the Carbon Compounds emitted due to consumption of fossil fuels (such as gas oil) that could cause Greenhhouse effects

Hope this helps <span />
8 0
3 years ago
Read 2 more answers
Where does all energy ORIGINALLY come<br> from?
labwork [276]

Answer:

the sun

Explanation:

8 0
3 years ago
_______________ can be accidental or intentional, and it can cause erosion.
maksim [4K]
Fire can be accidental or intentional, and it can cause erosion.
3 0
3 years ago
Read 2 more answers
Other questions:
  • What is leucoplasts?<br> Any body can define it?
    15·1 answer
  • Why is something like a cold, a condition that obviously affects homeostasis, not considered a disease?
    10·1 answer
  • Environmentalists observed the diminishing of _________ and global warming trends.
    6·1 answer
  • Escherichia coli, or E.coli, is a species of bacteria. Entamoeba histolytica, or E. histolytica, is a single-celled amoeba. What
    15·1 answer
  • Which statement best describes the use of land in the United States?
    13·2 answers
  • What is the point of dna replication?​
    5·1 answer
  • Fossils up to 75,000 years old can be dated with ______.
    13·2 answers
  • What is an important trait or skill for a scientist to have?
    9·2 answers
  • Why is there a larger biodiversity hot spot in New Zealand than Australia.migration of both animals and plants from Australia b.
    12·2 answers
  • What is the best way to test a hypothesis?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!