1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AleksAgata [21]
3 years ago
8

What does a blood pressure cup do

Biology
1 answer:
dolphi86 [110]3 years ago
6 0

Answer:

A blood pressure cuff is used to take blood pressure. The cuff has an inflatable rubber bladder that is fastened around the arm. A pressure meter indicates the cuff's pressure. A small, handheld air pump inflates the blood pressure cuff.

Explanation:

You might be interested in
Discuss the functions and sources of antioxidant micronutrients, phytochemicals, and antioxidant minerals.
dlinn [17]

Answer:

1. Petrochemicals are compounds that are produced by plants ("phyto" means "plant"). They are found in fruits, vegetables, grains, beans, and other plants. Some of these petrochemicals are believed to protect cells from damage that could lead to cancer.

2. Antioxidant micronutrients considered in the study

The antioxidant micronutrients considered are vitamins A, C, and E, copper, zinc, and selenium.

Explanation:

5 0
3 years ago
1. What is the basic ingredient of all clouds?
Andreas93 [3]
1. moisture/water
2. precipitation
3. evaporation
4.transpiration
5. warmer, more
6. vaporization
7. condensation nuclei
6 0
3 years ago
Read 2 more answers
The first known bird fossils date to which era of time
kramer

The first known bird fossil date to the mesozoic era of time.

Explanation:

  • The first known bird fossil is  Archaeopteryx.
  • Archaeopteryx were not exactly like modern birds and are called dinosaur like birds..
  • Carbon dating suggest that these birds evolved during the jurassic period of mesozoic era.
  • These are considered as the only birds of that era.
  • Ancestors of modern birds began to evolve during cretaceous period  and kept on evolving through Cenozoic era.
6 0
3 years ago
Read 2 more answers
What do the carbon, nitrogen, hydrologic, and mineral/phosphorus cycle all have in common?
OverLord2011 [107]

Answer:

They all include an exchange of gases with the atmosphere.

The carbon, oxygen, and nitrogen cycles are biogeochemical cycles meaning the chemicals spend a portion during the cycle in living things ( bio) and a portion in the nonliving environment

4 0
3 years ago
In this food web, the ____________ is the primary consumer and a herbivore. a shrew b red fox c willow tree d snowshoe rabbit
Yuki888 [10]
I would say d the snowshoe rabbit. shrews and red foxes are carnivores and trees are producers
5 0
3 years ago
Other questions:
  • Which of the following statements is FALSE? a. In the lag phase, cell death exceeds cell division. b. In the death phase, bacter
    10·1 answer
  • Which phenomenon usually brings warm, humid conditions to North Carolina?
    7·2 answers
  • Which intervals show f(x) increasing? Check all that apply.
    6·2 answers
  • The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body. A. circulatory; diges
    13·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What part of your brain controls your emotions
    12·1 answer
  • What is the key organism that ensures the<br> nitrogen cycle can run properly?
    11·1 answer
  • in an investigation on accuracy and precision, myriah measures the mass of a 10.00 g piece of metal several times. her measureme
    12·1 answer
  • Which of the samples shown below are eukaryotic?
    7·2 answers
  • Is a wildfire caused by an arsonist considered an extreme weather event?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!