1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klemol [59]
3 years ago
13

This graph shows the trend of increasing carbon dioxide (CO2) levels globally from the years 1700 to 2000. Based on your knowled

ge of CO2 and its correlation with atmospheric temperature, how will the global temperature graph look?
A.
The line in the temperature graph will run parallel to the line in the carbon dioxide graph.
B.
The temperature graph will show a negative correlation between CO2 percentage and air temperature.
C.
The greatest change in temperature will be from the years 1700 to 1800.
D.
The slope of the temperature graph will be lower than the slope of the carbon dioxide graph.
E.
The temperature will remain relatively constant from the years 1900 to 1950.

Biology
2 answers:
aliina [53]3 years ago
8 0

Answer: A

Explanation: The atmosphere acts as a dissymmetrical insulator, letting the heat of the Sun pass but retaining the heat of the Earth. Therefore, the higher the concentration of greenhouse gases, especially CO2, is, the higher the surface temperature of the Earth.

Nimfa-mama [501]3 years ago
7 0

The right answer is A.

The greenhouse effect is a natural process that significantly changes the surface temperature of our planet. And the latter is exerted mainly by carbon dioxide (CO2).

The atmosphere acts as a dissymmetrical insulator, letting the heat of the Sun pass but retaining the heat of the Earth. Therefore, the higher the concentration of greenhouse gases, especially CO2, is, the higher the surface temperature of the Earth.

You might be interested in
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Identify each of the following mixtures as either homogeneous or heterogeneous and as a solution, a suspension, or a colloid. Cr
fiasKO [112]

Answer:

Cranberry: Homo Solution Smoke: Hetero colloid

Explanation:

Just took the assignment  :)

6 0
3 years ago
Which of the following sets of materials is required by both eukaryotes and prokaryotes for replication? Group of answer choices
erastova [34]

Answer:

Double-stranded DNA.

Explanation:

Replication may be defined as the process of formation of the daughter DNA from the parent DNA with the help of enzymes and proteins. The three main process of replication are inititation , elongation and termination.

The double stranded DNA molecule undergoes the process of replication. Four different dNTPs - adenine, guanine, thymine and cytosine are required for the process of replication.  Primers are required for initiation of the process of replication and ori region is the inititaion point of replication.

Thus, the correct answer is option (a).

6 0
3 years ago
Three factors that can increase someone’s risk for developing cancer<br><br><br><br>​
mr_godi [17]
Are tobacco, sun exposure and radiation exposure

3 0
3 years ago
Within which structure in the human body does
shtirl [24]
Uterus is the answer
7 0
3 years ago
Other questions:
  • Heredity refers to the __________.
    9·2 answers
  •  A/An _______ is characteristic of children at age five. 
    9·2 answers
  • What is the function of Nucleus in human cell<br><br>i will 15 points pls​
    15·2 answers
  • Dr. snider, a geneticist, is looking for a slight variation of a particular gene that would cause a certain abnormality. he is l
    15·1 answer
  • The__ links the brain to the rest of the body.
    14·2 answers
  • A byproduct (sometimes called a waste product) of the anaerobic glycolysis energy
    13·1 answer
  • Give several reasons why five trained individuals might come up with different readings
    15·1 answer
  • What are the main causes of antimicrobial drug resistance?
    8·1 answer
  • Scientists are uncertain about how life began on Earth.<br>Why?​
    14·1 answer
  • Are cells and DNA the same thing?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!