1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brums [2.3K]
3 years ago
7

A teenage patient complains of frequently being tired and lethargic. The doctor notices the patient is pale and asks, "Do either

of your parents have anemia?" Why is the doctor asking the patient this question?
A. Anemia refers to a disease of the white blood cells that is caused by inadequate nutrition.
B. Anemia refers to a disease of the red blood cells that is caused by inadequate nutrition.
C. Anemia refers to a disease of the red blood cells that can be inherited.
D. Anemia refers to a disease of the white blood cells that can be inherited.
Biology
2 answers:
Butoxors [25]3 years ago
5 0
D, specifically because if the parents have/had this, it is likely the patient does
larisa86 [58]3 years ago
4 0
It would be none of these due to the fact that anemia refers to iron.
You might be interested in
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Mr. Adams asked his students to write the chemical symbol for the element zinc. He wrote the students’ answers on the whiteboard
Whitepunk [10]
The answer is b. The second letter (if there is one) is always written as lowercase
4 0
3 years ago
Read 2 more answers
Compare and Contrast Viruses and bacteria in regard to their structure.<br> Bacteria:<br> Viruses:
yarga [219]

Answer:

On a biological level, the main difference is that bacteria and free-living cells can live inside or outside a body, while viruses are a non-living collection of molocules that need a host to survive.

Explanation:

6 0
2 years ago
A heterogeneous mixture that has larger dispersed particles that settle over time is a
sergey [27]
<span>A heterogeneous mixture that has larger dispersed particles that settle over time is a suspension.</span>
3 0
3 years ago
Read 2 more answers
Which parts of the earthworm serve as its brain
SSSSS [86.1K]
The part of the worm that serves as its brain is the cerebral ganglion 
<span />
3 0
3 years ago
Other questions:
  • What are the requirements for a protein to be an integral membrane protein? (7.1)?
    7·1 answer
  • Humus consists of_____.
    7·1 answer
  • How did planetesmals form planets?
    10·2 answers
  • Which events contributed to life evolving on earth
    13·2 answers
  • What is the difference between a skilled hacker and an unskilled hacker (other than the
    8·1 answer
  • Is cellular respiration an endothermic or exothermic reaction
    7·1 answer
  • What might have been the first word out of Darwin’s mouth at the end of his research travels?
    13·2 answers
  • What is the 1st step of virus infection?
    10·2 answers
  • :-) :-) :-) :-) :-) :-) :-) :-) :-)
    10·1 answer
  • GIVING 20 POINTS FOR BEST ANSWER. More biology questions I don't understand. I would like all of them answered if possible.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!