1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liberstina [14]
3 years ago
11

The cholodny-went hypothesis has been proposed to explain how plants bend toward a directional light source. What does this hypo

thesis suggest?
Biology
1 answer:
ololo11 [35]3 years ago
7 0

Answer:

The cholodny-went model was proposed in 1927. This model explains the capability of the shoots to grow in the direction of the sunlight whereas the capability of the roots to grow downwards. The hypothesis suggested that both these directional growth occurred due to the asymmetrical distribution of the plant hormone, auxin. This model has been modified a number of times by other scientists but its general concept is accepted by most of the researchers.

You might be interested in
Please select the word from the list that best fits the definition: the movement of water from ocean through the atmosphere and
Airida [17]

Answer:

Water cycle

Explanation:

Water rains from the cloud into the ocean. Then the water gets sucked back up to atmosphere of the clouds

6 0
3 years ago
Read 2 more answers
Methane is a gas that helps trap the sun's energy within the Earth's atmosphere and is known as a (2 points)
Nikitich [7]
I'm assuming the answer would be greenhouse gas. 

Greenhouse gases are those that trap infrared radiation (from the sun) and contribute to the greenhouse effect. 
5 0
3 years ago
What structures found in the
Leviafan [203]

Answer:

A. chromosomes

Explanation:

Chromosomes are structures found in the center (nucleus) of cells that carry long pieces of DNA. DNA is the material that contains genes and is the building block of the human body.

Chromosomes come in pairs. Normally, each cell in the human body has 23 pairs of chromosomes (46 chromosomes in all), of which half comes from the mother and half from the father.

5 0
3 years ago
Assume that a base-pair substitution mutation converts a DNA triplet (AAT) to another DNA triplet (AAA). A second mutation now c
vagabundo [1.1K]

Answer:

The answer is "intragenic suppressor".

Explanation:

In this question, the second mutation on the inside of a mutated gene, that leads to both a simple restoration. Its second mutations were its instance of even a mutation suppresser because it contributed to both the evident recovery of its original phenotype from its second mutation within such a gene.

5 0
3 years ago
How are earthworms and fish similar?
dimaraw [331]
Materials eliciting increased tongue flicking and prey attack in garter snakes were isolated from both earthworm and fish prey. New extraction methods based on chloroform-methanol mixtures are valuable adjuncts to the more typical aqueous preparations. Both high- and low-molecular weight components from earthworms and fish were active. The similarity between the active chemicals in these two classes of prey was established using several methods of analysis.
3 0
3 years ago
Other questions:
  • Explain the purpose of the F1 offspring. The first one to answer correctly gets a thanks and gets marked brainliest.
    13·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which equation shows a disaccharide with the monosaccharides that make it up
    13·2 answers
  • In which region of the United States is new Mexico located in
    7·2 answers
  • Hi take points.....................​
    12·1 answer
  • Why one strand of dna used to make mrna?
    9·1 answer
  • Walking with muscular dystrophy is described as...
    5·1 answer
  • 3. What charts, tables, or drawings would clearly show what you have learned in this lab?
    8·1 answer
  • EXPERIMENT 1: How many fish with blue tags
    11·1 answer
  • Which does the termination of translation require?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!