1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
3 years ago
9

How Long do cats live

Biology
2 answers:
Lena [83]3 years ago
8 0

Answer:

2 to 16 yrs

Explanation:

Fantom [35]3 years ago
4 0

Answer:

Cats live about 12 years – 15 years (Domesticated)

You might be interested in
Which role do gametes play in reproduction?
Lesechka [4]
<span>C. Gametes are the sex cells, and each (sperm and ovum) contain half of the parent's genetic material. These cells will fuse to produce a zygote, which will usually contain the full number of genes required by an organism to live. If there is a chromosomal abnormality, such as a gamete with an extra chromosome, the offspring can either die in development or sometimes be born with physiological and/or developmental difficulties. An example of this phenomenon is trisomy 21, also known as Down Syndrome, in which the 21st chromosome bears 3 copies instead of the regular 2.</span>
3 0
3 years ago
Read 2 more answers
A biologist studying a desert ecosystem observes that the population of a lizard species increases following particularly hot, d
Alona [7]

Answer:

B.

Explanation:

Same but different because lizards are very similar to snakes. Snake are just more vicious.

6 0
3 years ago
a split-brain patient has a picture of a dog flashed to his right hemisphere and a cat to his left hemisphere. he will be able t
Bad White [126]

The cerebrum (brain) can be divided into two hemispheres: the left hemispheres and the right hemisphere. These hemispheres are separated by a deep longitudinal fissure (i.e., the cerebral fissure).

  • In this case, the patient will be able to identify the cat using his RIGHT-HAND.

  • The left brain hemisphere receives sensory information from and controls movements on the right part of the body, and vice-versa.

  • In consequence, the left brain hemisphere controls the movements of the right hand, whereas the right brain hemisphere controls the left hand.

Learn more in:

brainly.com/question/20975936?referrer=searchResults

8 0
3 years ago
Alfred wallace co-discovered evolution by natural selection with charles darwin.
lianna [129]
A. True 
"Charles Darwin is known as the father of evolution, but in fact Alfred Wallace, another British naturalist, was a co-discoverer of the theory- though Darwin got the most credit" 
5 0
3 years ago
The presence of useless eyes on a mole rat is evidence of which scientific theory?
Paha777 [63]

The answer to this question is

B: the theory of evolution

I hyope this is correct and helps

8 0
3 years ago
Other questions:
  • Why will these changes make it more difficult for the plants to grow?
    8·1 answer
  • Explain the types of energy transformations that occurs when a light bulb switch is turned on
    7·1 answer
  • f pink snapdragons of the F1 hybrids (RW) are crossed with red snapdragons of the parent plant (RR), what will be the ratio of f
    14·1 answer
  • Which option illustrates where the youngest crust is formed?
    14·2 answers
  • T
    6·2 answers
  • Which of these choices is a direct cost of using coal?
    13·2 answers
  • 3. Which of the folowing describes the function of the pancreas?
    15·2 answers
  • Folds and faults, extension stress, compression stress, and shear stress are all the result of what?
    12·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • /Written answers for these questions by 7/23?? will vote brainiest!! Just don't have a lot of time for this on top of my other c
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!