What term best describes a failure of the body's cells to respond to secretion of insulin?

1 answer:

4 0

Diabetes.

Diabetes is when your body's pancreas stop producing insulin, which is a hormone that helps regulate your blood sugar levels

You might be interested in

Each transfer RNA requires at least four specific recognition sites that must be inherent in its tertiary structure in order for

Jet001 [13]

Answer: The options are not included.

But the sites are;

Interaction with ribosomes.

Interaction with aminoacyl tRNA

synthase.

Attachment of the specific Amino acid.

Interaction with codon.

Explanation:

Transfer RNA is a type of RNA that help to translate messenger RNA sequence into protein. Each tRNA have two major areas; the anticodon and region for attaching specific Amino acids.

tRNAs function at specific sites in the ribosomes during mRNA deciding.

The four specific recognition sites of trna that must be inherent in it's tertiary structures in order for it to carry out it's role are;.

Interaction with ribosomes.

Interaction with aminoacyl tRNA synthase.

Attachment of specific Amino acid.

Interaction with codon.

4 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein