1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aneli [31]
3 years ago
15

The energy that produces ocean waves comes from

Biology
2 answers:
Shtirlitz [24]3 years ago
6 0
The moon that is my answer
kobusy [5.1K]3 years ago
5 0
The moon that is the answer to your question
You might be interested in
In most cases, single-gene mutations happen during _______________________. replication meiosis transcription translation
Andre45 [30]
In most cases, single-gene mutations happen during replication. During cell division, it is very common for this to happen to sequences of DNA in single genes.
6 0
4 years ago
"Free" or unattached ribosomes in the cytoplasm make proteins for:
Maru [420]

Answer:

The correct answer is a. intracellular use. ; see the explanation below, please.

Explanation:

Free ribosomes synthesize cytosine, nuclear, plasma membrane proteins (enzymes, actin, spectrin), mitochondria, peroxisomes.

5 0
4 years ago
A. Secretes hormones
Vadim26 [7]

Answer:

A. 3

B. 4

C. 5

D. 6

E. 2

F. 1

Explanation:

1. Integumentary system.

This is an organ system that consists of hair, skin, nails and exocrine glands with receptors that senses the outer stimulus and environmental conditions, through homeostasis maintain stability of the internal environment.

2. Nervous system.

It receives sensory information and signals, convert them to nerve impulses that are transmitted to the body and brain via the spinal cord using nuerons and axons. It also intergrates, retains and analyses information in the brain.

3.Endocrine system.

Secretes hormones and chemicals in response to stimulus from the nervous system to maintain balance using feedback loops i.e, negative and positive.

4. Lymphatic system.

Part of the immune system that consist of vessels that carries lymph, cleaning the blood by filtering lymph with foreign particles into the lymph node.

5. Urinary system.

Used to eliminate waste from the body, regulates blood pressure, volume and pH. It also used to retain electrolytes and metabolites.

6. Respiratory system.

Used for gaseous exchange using the blood, heart and lungs. Air enters the lungs, transported by blood and is pumped by the heart to all body parts where oxygen is dropped, carbon dioxide is collected by the veins to the lungs and released to the atmosphere.

8 0
4 years ago
Tmp/smx has two components that act on different steps in the folic acid biosynthesis pathway and are thus used together. sulfam
makkiz [27]

Trimethoprim-sulfamethoxazole (TMP-SMX) are a class of antibiotics used in the treatment of bacterial infections due to their inhibitory actions in the folic acid biosynthesis pathway of bacteria.

<h3>What is TMP-SMX?</h3>

Trimethoprim-sulfamethoxazole (TMP-SMX), otherwise known as co-trimoxazole, is a combination of two antimicrobial agents that work synergistically to inhibit the enzyme systems involved in the bacterial synthesis of tetrahydrofolic acid.

They are used in the treatment of urinary tract infections, respiratory tract infections, cholera, etc.

They can be administered intravenously or orally.

Therefore, Trimethoprim-sulfamethoxazole (TMP-SMX) are antibiotics used in the treatment of bacterial infections.

Learn more about bacterial infections at: brainly.com/question/2009215

7 0
3 years ago
Both vascular and nonvascular plants are
nikdorinn [45]

Answer:

a. is the correct answer of this question

8 0
3 years ago
Other questions:
  • The peripheral nervous system includes A. the cranial nerves and spinal nerves. B. all nerves and associated cells that are not
    11·2 answers
  • How can bacteria and humans both be classified as a living thing? Describe what defines a living thing.
    14·1 answer
  • What is the main function of the Krebs cycle?
    7·1 answer
  • What is the highest mountain in north america,how high is it?
    12·1 answer
  • ________a statement of scientific truth accepted by scientists
    8·2 answers
  • Define Fitness as it relates to adaptation​
    10·1 answer
  • PLEASE PLEASE PLEASE HELP PLEASE
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Some transcription signals are located thousands of base pairs upstream of the gene they regulate. How does the distant signal i
    9·1 answer
  • Which body fluid compartment contains high levels of k , large anions, and proteins?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!